-
No products found
because this supplier's products are not listed.
Sharvari Narendra, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 6 rubber stoppers (#6R, Ancare, Bellmore, NY) containing stainless steel ball-bearing sippers (TD-100 ...
-
No products found
because this supplier's products are not listed.
Ashley Maynard, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... + 6% FBS (Omega Scientific, Inc, FB-11) and spun in the centrifuge at 500xg for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Reuben McGregor, et al.,
bioRxiv - Immunology 2020
Quote:
... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
No products found
because this supplier's products are not listed.
Swarna L. Vijayaraj, et al.,
bioRxiv - Immunology 2021
Quote:
... E3 (0.5 μM, 6 μl, His-cIAP1, Boston Biochem, E3-280) and 15 μl of purified FLAG-IL-1β in Ubiquitin assay buffer containing 2 mM ATP (total volume of 30 μl) ...
-
No products found
because this supplier's products are not listed.
Charles D Cox, et al.,
bioRxiv - Biophysics 2021
Quote:
... and the cells broken with a TS5/48/AE/6□A cell disrupter (Constant Systems) at 31,000□psi at 4°C ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Two biotinylated glycan analogs (3’SLN: Neu5Acα2-3Galβ1-4GlcNAcβ and 6’SLN: Neu5Acα2-6Galβ1- 4GlcNAcβ) were purchased (GlycoTech, Gaithersburg, MD). Three biotinylated glycans Neu5Acα2- 3Galβ1-4(Fucα1-3)GlcNAcβ (sLeX) ...
-
No products found
because this supplier's products are not listed.
Rebekah Honce, et al.,
bioRxiv - Microbiology 2021
Quote:
... and oseltamivir carboxylate (Toronto Research Chemicals, Lot 3-SKC-52-1, Purity 98%) with a qualified LC MS/MS assay ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Jack P. K. Bravo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and nanoPOP-6 polymer (Molecular Cloning Laboratories). The oven temperature was set to 65°C ...
-
No products found
because this supplier's products are not listed.
Wolfgang G. Pfeifer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Excess sample solution was subsequently wicked off with filter paper (Whatman #4) and the grid stained with two 6 µl drops of 1% aqueous Uranyl acetate (SPI Supplies) solution ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Eric P. Schultz, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 6% Fetalgro® (Rocky Mountain Biologicals, Missoula, MT, USA). Retinal pigment epithelial cells (ARPE19)(American Type Culture Collection ...
-
No products found
because this supplier's products are not listed.
Amit Rahi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... followed by incubation for 5 min and intermittent washing with 3 chamber volumes of buffer B: PLL PEG biotin (0.1 mg ml-1, Susos, AG), Streptavidin (0.625 mg ml-1 ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Mark Terasaki, Jason Cory Brunson, Justin Sardi,
bioRxiv - Cell Biology 2020
Quote:
... with a 6 mm wide histo diamond knife (Diatome, Hatfield, PA) was used cut 500 nm thick sections ...
-
No products found
because this supplier's products are not listed.
Nadejda Bozadjieva Kramer, et al.,
bioRxiv - Physiology 2020
Quote:
Insulin levels (6-hour fasting) were measured with ELISAs (Crystal Chem) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Craig T. Connors, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and 6 weeks-of-age were analyzed by ELISA for insulin (Alpco) and glucagon content (Mercodia) ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Sara F. Costa, et al.,
bioRxiv - Microbiology 2023
Quote:
... One microliter of each sample was mounted on a layer of 1.2% (w/v) agarose in 1:3 (vol/vol) TSB/PBS placed on a glass plate (Bio-Rad Mini-PROTEAN Short Plate) with a coverslip placed on top of each sample ...
-
No products found
because this supplier's products are not listed.
Ugo Dionne, et al.,
bioRxiv - Systems Biology 2020
Quote:
... prey strains are each expressing a gene of interest fused at its 3’ end to the DHFR F[3] and are resistant to hygromycin B (HPH 250 μg/ml, Bioshop Canada). The same BY4741 strains were used in the growth assays with the addition of knockout (KO ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... hMOs were incubated in a shaker (100 rpm, 37°C) for 3 days with primary antibodies: rabbit anti-tyrosine hydroxylase (TH, 1:500, Pel-Freez Biologicals, AR, USA) and chicken anti-microtubule associated protein 2 (MAP2 ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the samples were further treated further with 50 mU of chondro-6-sulfatase (Seikagaku). Samples were centrifuged ...
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (3) Spin-coating SU-8 precursor (SU-8 2000.5, MicroChem) at 3000 rpm ...
-
No products found
because this supplier's products are not listed.
Yize Li, et al.,
bioRxiv - Microbiology 2020
Quote:
... At the indicated times post-infection cells were fixed onto glass coverslips (Calu-3 coverslips were coated with rat tail collagen type-1: Cell Applications, Inc. Cat. # 122-20) with 4% paraformaldehyde for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Ruhul Amin, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 6-well plates with elastic moduli of 0.2 kPa (considered soft) was purchased from Matrigen. Regular 6-well tissue culture dishes were used to represent stiff matrices (elastic moduli is >GPa) ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Jean Farup, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and Collagen 3 (Cat nb GWB-7D650E, Genway Biotec Inc, CA, USA). After incubation in primary antibodies the membranes were incubated 1 hour with HRP-conjugated secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Linda D. Hicks, et al.,
bioRxiv - Microbiology 2021
Quote:
... or 3) human factor H-depleted serum (FHDS; Complement Technology; Tyler, TX) diluted in HIB to give a 50% concentration ...
-
No products found
because this supplier's products are not listed.
Teodors Pantelejevs, Marko Hyvönen,
bioRxiv - Biochemistry 2022
Quote:
... lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), after which column matrix was washed with 10 CV Nickel Buffer A ...
-
No products found
because this supplier's products are not listed.
Jiang-An Yin, et al.,
bioRxiv - Genomics 2023
Quote:
... Viral titers of the sgRNA libraries were determined by a 6-point dose response in 6-well plates by puromycin selection and determination of live and dead cells (T.spiezzo, Cellecta) or flow cytometry of RFP+ cells (Brunello ...
-
No products found
because this supplier's products are not listed.
Jugal Kishore Das, et al.,
bioRxiv - Immunology 2022
Quote:
... male C57BL/6 mice were injected with an emulsion of 100 µl of chick type II collagen (Chondrex; 100 µg) in Complete Freund’s Adjuvant (CFA ...
-
No products found
because this supplier's products are not listed.
Marine Tessier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Microglia interleukines production was analyzed the same way with the Mouse Interleukin 6 ELISA Kit (Biosensis®, BEK-2043-1P) and the Mouse Interleukin 10 ELISA Kit (Biosensis® ...
-
Cat# F6,
USD $18.00/EA
Ask
Bocheng Yin, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The stock solution of 0.5 M biotin-dPEG®3-benzophenone (biotin-BP, 10267, Quanta BioDesign) in anhydrous DMSO (89139-666 ...
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
No products found
because this supplier's products are not listed.
Alena Rudkouskaya, et al.,
bioRxiv - Bioengineering 2019
Quote:
... The excitation was set to 750 nm, and the emission filter were 820±6 nm (Semrock, FF01-820/12-25) and 810±45 (Chroma Technology, ET810/90). The imaging parameters were set the same for all mice.
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPVI (JAQ1-FITC, #M011-1, Emfret Analytics, 1:10), integrin α5 (CD49e ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti–mouse LYVE-1 (11-034, AngioBio, 1:800), Goat anti– human PROX1 (AF2727 ...
-
No products found
because this supplier's products are not listed.
Hua He, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or NKX2-1 antibody (Seven Hills Bioreagents, WRAB-1231, 1:1000) followed by incubation with TrueBlot HRP-Conjugated secondary antibody (Rockland Immunochemicals Inc ...
-
No products found
because this supplier's products are not listed.
Sergej Franz, et al.,
bioRxiv - Microbiology 2020
Quote:
... AP1153a, Abcepta, 1:500), rabbit anti-CHIKV antiserum (IBT Bioservices, 1:10,000) or mouse anti-p24 (ExBio, 1:1000). Secondary antibodies conjugated to Alexa680/800 fluorescent dyes were used for detection and quantification by Odyssey Infrared Imaging System (LI-COR Biosciences).
-
No products found
Catalina Pereira, et al.,
bioRxiv - Genetics 2021
Quote:
... using a 1:1 ratio of WesternBright ECL Luminol/enhancer solution to WesternBright Peroxide Chemiluminescent peroxide solution (Advansta). Antibody information is provided in key resources table.