-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Peter Njenga Ng’ang’a, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 6 × 104 cells in 1 mL DMEM medium (Pan Biotech) were grown for 48 h before addition of 5.8 nM of toxin ...
-
No products found
because this supplier's products are not listed.
Anna Zhuravskaya, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3 µM CHIR99021 (Cambridge Bioscience, cat# SM13-1), 0.5 mM L-Glutamine (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
SAKIRUL I KHAN, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and rabbit polyclonal anti-caspase 3 (1:1000; Bioss) plus mouse monoclonal anti-CB (1:1000 ...
-
No products found
because this supplier's products are not listed.
Takuya Yoshida, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and with varied length varied (3-6 mm depending on the place) (RWD Life science Inc, US and Doric Lenses, Canada). The fiber probe was secured by adhesion bond (Loctite 454 ...
-
No products found
because this supplier's products are not listed.
Teng-Chieh Yang,
bioRxiv - Bioengineering 2023
Quote:
... One (1) μm yellow PSP and 6 μm red PSP were from Polyscience Inc ...
-
No products found
because this supplier's products are not listed.
Miguel Alejandro Lopez-Ramirez, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 6-8 μM (Spherotech) were washed twice with wash buffer (20 mM Tris ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Gabriela Souza Barbosa, et al.,
bioRxiv - Physiology 2023
Quote:
Male and female C57Bl/6 mice (6-8 weeks of age) were divided into 4 groups and fed either a normal diet (ND; Research Diets, D12328 ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
P. Lejeune, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Jiffypots® with weak or abnormal plantlets were discarded and the others were transplanted into 12-cm square plastic cultivation pots filled with 1.5 L of leaf mould and baked clay (4:1) mixed with 6 gr.L−1 of slow release fertilizer (Osmocote Exact Standard 5-6 M, ICL Specialty Fertilizers). The pots were fitted at the bottom with a 2 x 10 cm felt wick and randomly placed on the deck of the cultivation gutters described above ...
-
No products found
because this supplier's products are not listed.
Yapeng Li, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The amounts of IL-6 (LS-F31434-1, LifeSpan BioSciences) and TNFα (LS-F57505-1 ...
-
No products found
because this supplier's products are not listed.
Monica J. Chau, et al.,
bioRxiv - Neuroscience 2021
Quote:
... B cell lymphoma 6 (BCL-6) (MyBiosource, San Diego, CA), samples were neat ...
-
No products found
because this supplier's products are not listed.
Andreas K Brödel, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... cell cultures were shifted to 37°C for 3 to 6 hours in an orbital shaker at 180 rpm (New Brunswick Innova 44). Samples were centrifuged for 10 min at 4,500g and cell pellets were resuspended and lysed with B-PER reagent (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
No products found
because this supplier's products are not listed.
Eric M. Mulhall, et al.,
bioRxiv - Biophysics 2019
Quote:
Silica microspheres (200 μL of 1% w/v, 3 μM; Bangs Laboratories) were cleaned and hydroxylated by first washing them in a glass tube in MilliQ water ...
-
No products found
because this supplier's products are not listed.
Eva Morgenstern, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 50mM NH4HCO3/acetonitrile (3/1) and 50mM NH4HCO3/acetonitrile (1/1) while shaking gently in an orbital shaker (VXR basic Vibrax, IKA). Gel pieces were lyophilized after shrinking by 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Qingtao Sun, et al.,
bioRxiv - Neuroscience 2023
Quote:
Biotinylated human IL-6 solution (Acrobiosystems, IL-6-H8218 ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Elizabeth B. Draganova, Ekaterina E. Heldwein,
bioRxiv - Microbiology 2021
Quote:
... a total of 10 μL of GUVs with a 3:1:1 molar ratio of POPC:POPS:POPA containing ATTO-594 DOPE (ATTO-TEC GmbH) at a concentration of 0.2 μg/μL was mixed with 1 μM NEC220 (final concentration) ...
-
No products found
because this supplier's products are not listed.
Jennifer Schwarz, et al.,
bioRxiv - Biochemistry 2021
Quote:
... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
No products found
because this supplier's products are not listed.
Jessica B. Sarthi, et al.,
bioRxiv - Physiology 2023
Quote:
... Mice were anesthetized with oxygen-delivered isoflurane (1-3%) at 1 L/min via a vaporizer (Braintree Scientific, Inc, Braintree, Mass). Mouse temperature was monitored by rectal probe and maintained at 37°C through automated warming using a controlled warming pad (ATCC 2000 ...
-
No products found
because this supplier's products are not listed.
Martin Jakubec, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 10% FBS and 1% Pen-Strep) were seeded in 6 well plates pre-coated with poly-L-lysine (Boster). At the same time pBECS were sowed in transwells (TW ...
-
No products found
because this supplier's products are not listed.
Roy A. Ehling, et al.,
bioRxiv - Immunology 2021
Quote:
Transfected cells were sorted for HDR+ by staining for Strep-Tactin-APC 1:100 (IBA lifesciences, Cat: 6-5010-001) and anti-hIgG AF488 1:100 (Jackson ImmunoResearch ...
-
No products found
because this supplier's products are not listed.
Roshan Nepal, et al.,
bioRxiv - Microbiology 2023
Quote:
... Resorufin fluorescence was monitored at the 1- hr interval for 6 hours using the CLARIOstar Plus (BMG Labtech, Ortenberg, Germany) microplate reader (excitation = 530 nm ...
-
No products found
because this supplier's products are not listed.
Valérie Clavet-Fournier, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The ACSF solution was continuously infused with 5 % CO2 and delivered with a flow of ∼1 ml/min (MINIPULS 3 Peristaltic Pump, Gilson).
-
No products found
because this supplier's products are not listed.
Ningke Hou, et al.,
bioRxiv - Microbiology 2019
Quote:
... SSP4 (3’,6’-Di(O-thiosalicyl)fluorecein) was purchased from DOJINDO MOLECULAR TECHNOLOGIES (Bibli et al ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... hiPSCs were seeded onto freshly coated 6-well plates 3 days prior to transduction with premade LV-CAG-eGFP lentivirus (Kerafast FCT149, 1 × 108 CFU/ml). Polybrene (2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) was purchased from Chem-Impex. Falcon cell strainer tubes were purchased from Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Wenyang Li, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Blots were washed 3 times with Tris Buffered Saline-Tween (TBST) buffer (Boston BioProducts, Cat. # IBB-181–6) and developed using SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Daniel Pölöske, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Ba/F3 cells were grown in the presence of 1 ng/mL murine IL-3 (mIL-3, Immunotools). Mycoplasma contamination was regularly excluded using the MycoAlert mycoplasma detection kit (Lonza Group AG ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... at 1:3 ratio and spread over the CometSlide (Trevigen). Slides were dried at room temperature for 2 minutes and immersed into neutral lysis buffer overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Angélica Díaz-Basabe, et al.,
bioRxiv - Immunology 2023
Quote:
... STAT-3 (1:600, E-Ab-40131, Elabscience, Houston, Texas, USA); GSK-3ab (1:500 ...
-
No products found
because this supplier's products are not listed.
Stefan E. Spirig, et al.,
bioRxiv - Neuroscience 2023
Quote:
HSP90AA1I-1 together with CS-KI-1 (Figures 4G-H, 5C-D and 6) were newly synthesized by Enamine. CS-KI-2 was purchased from MolPort (Figures 4I ...
-
No products found
because this supplier's products are not listed.
Jennifer O’Brien, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and chicken anti-beta-tubulin 3 (Aves Labs, TUJ-0020, 1:500).
-
No products found
because this supplier's products are not listed.
Dasmanthie De Silva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The WPRE 3’-UTR sequence was amplified from the CD813A-1 (System Biosciences) vector.
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Wassim Eid, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit polyconal to 14-3-3 (SA-483, Biomol); rabbit polyconal to CHK1-pS345 (2348S ...
-
No products found
because this supplier's products are not listed.
Marcel Bach-Pages, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Arabidopsis leaves of mature plants (5-6 weeks old) were infiltrated with either flg22 (1 μM; Anaspec) or H2O (mock ...
-
No products found
because this supplier's products are not listed.
Fiorella Ghisays, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO), denatured at 75°C for 5 minutes and incubated at room temperature for 16hr ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... 3-oxoLCA (Steraloids (C1750-000 ...
-
No products found
because this supplier's products are not listed.
Philipp Gaugler, et al.,
bioRxiv - Plant Biology 2022
Quote:
... They were then diluted 1:200 in 2 mL fresh medium supplemented with 6 μCi mL−1 [3H]-myo-inositol (30–80 Ci mmol−1; Biotrend; ART-0261-5) and grown overnight at 28°C in a spinning wheel ...
-
No products found
because this supplier's products are not listed.
Iris Lindberg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... proSAAS (AAV 2/6; Vigene Biosciences) or enhanced green fluorescent protein (GFP; AAV 2/6; Vector Biolabs) was driven by the human SYN1 promoter ...
-
No products found
because this supplier's products are not listed.
Bader M. Jarai, Catherine A. Fromen,
bioRxiv - Bioengineering 2021
Quote:
BMMs in 6-well plates (1×106 cells/well) were detached using Accutase® (Innovative Cell Technologies, Inc.) and washed twice with PBS supplemented with 2% FBS ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 6-Azidohexanoic Acid Ester (Click Chemistry tools, > 95%), Alkyne-PEG4-NHS Ester (Click Chemistry Tools > 95%) ...
-
No products found
because this supplier's products are not listed.
Toshiyuki Harumoto,
bioRxiv - Microbiology 2023
Quote:
... 6 µl GFP-Trap magnetic agarose (ChromoTek, gtmak-20) pre-equilibrated with dilution buffer was added to the diluted lysates ...
-
No products found
because this supplier's products are not listed.
Kailash Venkatraman, et al.,
bioRxiv - Biophysics 2023
Quote:
... Cells were back-diluted 1:100 in fresh CSM containing 2% glucose or 3% glycerol and shaken in a plate reader (Tecan) for 48 hours ...