-
No products found
because this supplier's products are not listed.
Arumoy Chatterjee, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The deuterated internal standards 2-(4-Hydroxyphenyl)ethyl-1,1,2,2-d4-amine HCl and beta-Hydroxytyramine (α-d2, β-d1) HCl were supplied by Medical Isotopes, Inc ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Inge M. N. Wortel, et al.,
bioRxiv - Microbiology 2022
Quote:
... The sample was diluted 1:10 with BHI and 8 μl of 1:10 dilution was used on a non-charged slide (Globe Scientific Cat No 1324W) to check motility ...
-
No products found
because this supplier's products are not listed.
Pengliang Wei, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Proteins (1 μg) were separated on an 8% SDS-PAGE gel containing 40 μM MnCl2 and 20 μM Phos-tag (NARD Institute), which was used for identification of phosphorylated SOG1 protein ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Zi Ye, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Defibrinated sheep blood was stored at 4°C and used within 2 weeks of purchasing (Hemostat Laboratories, Dixon, CA). Human foot odorants were provided as cloth strips cut from socks that had been continually worn for 5 days by a 30-year-old male volunteer and thereafter incubated overnight at 37°C in a sealed Ziploc plastic bag (SC Johnson ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... three sections for each brain electroporated at E14.5 with pUB6-TOM and pSilencer-U6-scram (number of brains, n = 4) or pSilencer-U6-miR-137 (number of brains, n = 4) and injected with retrobeads (Lumafluor) at P9 ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-Spn serotype 4 (#16747, Statens Serum Institut) and cleaved-caspase-3 (AF835SP ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 2H,2H,3H,3H-Perfluorooctane-1-sulfonate (6:2 FTSA, CAS 59587-39-2, purity ≥ 97%) were from Synquest Laboratories (Alachua, FL). HSA (CAS 70024-90-7 ...
-
No products found
because this supplier's products are not listed.
Britta Lötstedt, et al.,
bioRxiv - Genomics 2022
Quote:
... six spatial microarrays were created on amine-activated Codelink slides (Surmodics, USA). Printing was performed by ArrayJet LTD (Scotland ...
-
No products found
because this supplier's products are not listed.
Huaqi Su, et al.,
bioRxiv - Biochemistry 2024
Quote:
... The pooled HD samples were made up to 8 mL with PBS and equally divided into 16 aliquots of 500 µL (4 aliquots for each of the 4 SEC column types) and loaded onto IZON qEVoriginal™ 35nm or 70nm (IZON Science), or home-made Sepharose™ CL-4B or CL-6B (Sigma Aldrich ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Trevor S. Wendt, Rayna J. Gonzales,
bioRxiv - Physiology 2023
Quote:
... HBMECs at density of 3 to 4 × 105/cm2 were seeded onto glass coverslips coated with attachment factor (Cell Systems; Catalogue number: 4Z0-201) within 6-well plates at passage 7 ...
-
No products found
because this supplier's products are not listed.
Doris Krauter, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Western Blots were incubated overnight at 4 °C in primary antibodies against PMP22 (1:1000, Assay Biotech), PTEN (1:1000 ...
-
No products found
because this supplier's products are not listed.
KJ Suchacki, et al.,
bioRxiv - Physiology 2020
Quote:
... 4 μm Diamond Hydride silica column (Microsolv Technologies, NJ, USA) and a linear gradient from 65% buffer B (0.1% formic acid in Acetronitrile ...
-
No products found
because this supplier's products are not listed.
Tomoki Takeda, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Rats (8 weeks old) were administered a single intratracheal dose of clodronate liposome or control liposome (LIPOSOMA, Inc., Amsterdam, The Netherlands) at a dose of 1 ml/kg ...
-
No products found
because this supplier's products are not listed.
Wen Li, et al.,
bioRxiv - Bioengineering 2020
Quote:
... the organic phase was prepared by mixing 20 μL siRNA (4 nmol in water) with 1 mL PLGA (Durect Corporation) (5mg/mL in acetone ...
-
No products found
because this supplier's products are not listed.
Alyssa F. Pybus, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Samples were incubated at 4°C overnight with primary antibodies diluted in blocking buffer: GFAP (1:100, Diagnostic Biosystems Mob064), NeuN (1:200 ...
-
Recombinant Mouse Antibody (B1-8) is capable of binding to 4-Hydroxy-3-Nitrophenyl Acetate.
Cat# PABZ-004,
Inquiry
Ask
HJ Monzo, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-SSEA-4 scFv was replaced with anti-GFP scFv (Creative Biolabs). The CMV promoter was replaced with EF-1α for optimal expression of long RNA encoding multiple gene products ...
-
No products found
because this supplier's products are not listed.
Chan Ho Park, et al.,
bioRxiv - Plant Biology 2022
Quote:
... anti-BSL2/3 (AbFrontier; 1:2,000 dilution), anti-FLAG (Sigma ...
-
No products found
because this supplier's products are not listed.
Justin Riddle, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The P4 (4-pregenen-3,20-dione) enzyme immunoassay kit was provided by Salimetrics Inc (State College ...
-
No products found
because this supplier's products are not listed.
Yuichiro Honda, et al.,
bioRxiv - Pathology 2020
Quote:
... The sections were blocked with 5% bovine serum albumin in PBS for 60 min and incubated overnight at 4°C with a mouse anti-CD-11b primary antibody (1:2000; BMA Biomedicals, Augst, Switzerland) or a rabbit polyclonal anti-dystrophin primary antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Benjamin A. Unruh, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 1 µg of yeast spike-in RNA (gift from Dr. Silke Hauf: Virginia Tech) labeled with 4-thiouracil (Neta Scientific, CMX-21484-1G) for 1 hr ...
-
No products found
because this supplier's products are not listed.
Sydney Risen, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... One section per animal was deparaffinized and stained with hematoxylin (Cancer Diagnostics, Cat#: #HTV-4) and eosin (Cancer Diagnostics ...
-
No products found
because this supplier's products are not listed.
Lara N. Janiszewski, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Media with essentially no Zn was made by adding 3 µM 2-{[Bis(2-pyridinylmethyl)amino]ethylamino}benzenesulfonic (ZX1, an extracellular Zn chelator(61)) (Strem Chemicals, Inc.) to Chelex media ...
-
No products found
because this supplier's products are not listed.
Youichi Tajima, Futoshi Shibasaki, Hisao Masai,
bioRxiv - Cancer Biology 2022
Quote:
... Proteins were separated by SDS-PAGE on 4-20 % gradient precast gel (EZBiolab Precast Gel, WSHT, Shanghai) at 100 V for 75 min ...
-
No products found
because this supplier's products are not listed.
Andrew Barszczyk, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4.5 x 104 dissociated cells in 60 μl of plating medium were plated on 12 mm coverslips (#194310012; Bellco) pre-coated with 0.1 mg/ml poly-D-lysine hydrobromide solution (#P0899 ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Wenxu Zhang, et al.,
bioRxiv - Bioengineering 2022
Quote:
De-identified human kidney tissue sections (30μm) were prepared from 4% v/v PFA-fixed frozen biopsy samples using a Compresstome (VF-210-0Z, Precisionary). Samples were imaged between 1mm thick glass slide and #1 thickness coverglass ...
-
No products found
because this supplier's products are not listed.
Heather A. Danhof, et al.,
bioRxiv - Microbiology 2023
Quote:
... and the slides were incubated at 4°C in a humid slide staining tray (Newcomer Supply, Middleton, WI, USA) overnight ...
-
No products found
because this supplier's products are not listed.
Derin Sevenler, Mehmet Toner,
bioRxiv - Bioengineering 2023
Quote:
Stock solutions of 4 mg/mL HA were typically prepared by dissolving 1.6 MDa sodium hyaluronate (HA15, Lifecore Biomedical) in phosphate buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Eun Hye Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
... Cells were washed and stained with antibodies against cell surface molecules in PBS containing 4% of human serum (Valley Biomedical). NGFR was detected with a 20 μl per million cells of Alexa Flour 647 conjugated α-NGFR (BD Bioscience) ...
-
No products found
because this supplier's products are not listed.
Rebekah Honce, et al.,
bioRxiv - Microbiology 2021
Quote:
... and oseltamivir carboxylate (Toronto Research Chemicals, Lot 3-SKC-52-1, Purity 98%) with a qualified LC MS/MS assay ...
-
No products found
because this supplier's products are not listed.
Alan P. R. Lorenzetti, et al.,
bioRxiv - Systems Biology 2022
Quote:
... Cell pellets were resuspended in Milli-Q water and disrupted at 4°C using ceramic beads (Mo Bio Laboratories) and a Precellys 24 homogenizer (Bertin Corp). Protein content was determined by bicinchoninic acid assay (BCA ...
-
No products found
because this supplier's products are not listed.
Hiroshi Yamaguchi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Methylated gold nanoparticles (final 1:2 dilution; CGM2K-15-25, Cytodiagnostics) were added as fiducial markers ...
-
No products found
because this supplier's products are not listed.
Jack P. K. Bravo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and nanoPOP-6 polymer (Molecular Cloning Laboratories). The oven temperature was set to 65°C ...
-
him-8 Antibody for ELISA, ICC/IF
Cat# CDC-07,
0.1 mg, Inquire
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
George R. Nahass, et al.,
bioRxiv - Biochemistry 2020
Quote:
... We preloaded plates with 6 glass or silica beads (1 mm in diameter, BioSpec Products or 0.8 mm, OPS Diagnostics, respectively) per well ...
-
No products found
because this supplier's products are not listed.
Ahmed Ali, et al.,
bioRxiv - Biophysics 2023
Quote:
... and sequentially in 1:3 dilution steps added to the wells of PEG-BSA coated ELISA plates (PBSA20PL, Life Diagnostics, Inc.) The plates were incubated for 2 h at RT to allow antibody binding ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Kelly L. Buchanan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or the sweet taste receptor inhibitor (T1R2/3) gurmarin (Peptides International) were dissolved into 1M sucrose ...
-
No products found
because this supplier's products are not listed.
Melika Shahhosseini, et al.,
bioRxiv - Bioengineering 2022
Quote:
... supplemented with 2% heat-inactivated FBS (Atlas Biologicals), and 1mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Kira Cozzolino, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Nuclear run-ons were performed for 3 minutes at 37°C on a Groovin’ Tubes thermoshaker (Boekel Scientific, 270500), on a mixture of 10 million human and 100,000 Drosophila melanogaster nuclei per replicate ...
-
No products found
because this supplier's products are not listed.
Ekaterini Maria Lyras, et al.,
bioRxiv - Immunology 2022
Quote:
... Lyve-1 (ReliaTech 103-PA50AG; 1:500), Podoplanin (Biolegend 156202 ...
-
No products found
because this supplier's products are not listed.
Tatsuaki Kurata, et al.,
bioRxiv - Microbiology 2021
Quote:
... Next day the plasmid was extracted from 3 mL of the culture using Favorprep Plasmid Extraction Mini Kit (Favorgen Biotech Corp.). 500 ng of the plasmid mix was again transformed into BW25113 carrying a toxin expression plasmid and let to recover as before ...
-
No products found
because this supplier's products are not listed.
Manami Suzuki-Karasaki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 1 μM OxiOrangeTM or 1 μM HydropTM (Goryo Chemicals, Sapporo, Japan) for 20 min ...
-
No products found
because this supplier's products are not listed.
Akash D. Chakraborty, et al.,
bioRxiv - Physiology 2023
Quote:
... SERCA2 (1:5000, Badrilla), CSQ2 (1:3000 ...
-
No products found
because this supplier's products are not listed.
Tiphaine Péresse, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 1% antibiotics (Zell Shield, Minerva Biolabs) and were incubated at 37°C in a 5% CO2 humidified atmosphere ...
-
No products found
because this supplier's products are not listed.
Aviad Ben-Shmuel, et al.,
bioRxiv - Immunology 2021
Quote:
... Rabbit anti-pSHP-1 (S591) (ECM Biosciences), Rabbit anti-pPLCγ1 (Y783 ...