-
No products found
because this supplier's products are not listed.
Damian L. Trujillo, et al.,
bioRxiv - Immunology 2019
Quote:
Purified mouse-adapted influenza A/PR/8/34 (H1N1) was purchased from Advanced Biotechnologies Inc ...
-
No products found
because this supplier's products are not listed.
Sophie Girardin, et al.,
bioRxiv - Neuroscience 2021
Quote:
... it was first immersed in a solution of 4 % Tergazyme (Alconox, 1304-1) for 24 h to remove cell culture and proteins ...
-
No products found
because this supplier's products are not listed.
Yasuhiro Takenaka, et al.,
bioRxiv - Cell Biology 2021
Quote:
Production of hydroxyl radical (.OH) and hypochlorous acid (HClO) were measured using the OxiORANGE reagent (Goryo Chemical, Sapporo, Japan). H2O2 and NO were detected by HYDROP and diaminofluorescein-FM diacetate (DAF-FM DA)(Goryo Chemical ...
-
No products found
because this supplier's products are not listed.
Tiphaine Péresse, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 1% antibiotics (Zell Shield, Minerva Biolabs) and were incubated at 37°C in a 5% CO2 humidified atmosphere ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... incubated with diluted mouse serum (1:8 or 1:16 dilution) and biotinylated detection antibodies (mAB2:1, UmanDiagnostics). Upon adding streptavidin-conjugated β-galactosidase (Quanterix) ...
-
No products found
because this supplier's products are not listed.
Alejandro A. Pezzulo, et al.,
bioRxiv - Genomics 2021
Quote:
... quenching of endogenous peroxidase (3% hydrogen peroxide, 8 minutes) and blocking of nonspecific stain (Background Buster x 30 minutes, Innovex Biosciences, Richmond, CA, USA). A mouse monoclonal anti-p63 antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Pengliang Wei, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Proteins (1 μg) were separated on an 8% SDS-PAGE gel containing 40 μM MnCl2 and 20 μM Phos-tag (NARD Institute), which was used for identification of phosphorylated SOG1 protein ...
-
No products found
because this supplier's products are not listed.
A Castellanos-Gonzalez, et al.,
bioRxiv - Microbiology 2022
Quote:
Human ileocecal cells (HCT-8 cells, ATCC, Manassas, VA) and Cryptosporidium parvum parasites (Waterborne, INC, New Orleans, LA) were used for in vitro studies ...
-
No products found
because this supplier's products are not listed.
Jean-Hugues Guervilly, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cells were usually fixed and stained 7 to 8 days later when visible colonies could be counted with a Scan 1200 automatic colony counter (Interscience).
-
No products found
because this supplier's products are not listed.
Ying Zhan, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Acid-terminated PLGA (Mw: 25,000 g mol−1, 50:50 lactic acid:glycolic acid, acid end‐capped, Akina Inc. PolySciTech, West Lafayette, IN) was dissolved with dimethylformamide (DMF ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
D. Brent Halling, et al.,
bioRxiv - Biophysics 2022
Quote:
... Ca2+ chelators were used in the intracellular solution to control free Ca2+ and (+)-(Crown-6)-2,3,11,12-tetracarboxylic acid (Synquest Laboratories) was used to chelate any contaminating barium to prevent barium block of channels ...
-
No products found
because this supplier's products are not listed.
Kevin G. Burfeind, et al.,
bioRxiv - Immunology 2019
Quote:
WT C57BL/6J male mice aged 8-10 weeks were injected IP with the alkylating agent treosulfan (Ovastat®, a generous gift from Joachim Baumgart at Medac GmbH, Germany) at a dose of 1500 mg/kg/day for 3 consecutive days prior to the day of bone marrow transplant (BMT) ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Lama El Cheikh Hussein, et al.,
bioRxiv - Neuroscience 2021
Quote:
... tail-tip blood (6 µl) was collected from 4 mice at ZT7 and ZT12 to check corticosterone levels (ELISA kit From Assaypro).
-
Carbohydrate
Cat# GOS0108S,
Inquiry
Ask
Samantha L. Fossa, et al.,
bioRxiv - Biochemistry 2023
Quote:
... N-Acetyl-D-glucosamine-6-phosphorylcholine (GlcNAc-6-PC) and N-acetyl-D-glucosamine-6-phosphoethanolamine (GlcNAc-6-PE) were synthesized by Creative Biolabs (Shirley, NY, USA). 6-O-phosphorylcholine-D-glucopyranose (Glc-6-PC) ...
-
No products found
because this supplier's products are not listed.
Barnabe D. Assogba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... version 6 (DNAStar). Consensus sequences were derived from at least two independent forward and reverse sequences ...
-
No products found
because this supplier's products are not listed.
King L. Hung, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... were diluted 1:4 in hybridization buffer (Empire Genomics) and added to the sample with the addition of a slide ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Isao Masuda, et al.,
bioRxiv - Microbiology 2021
Quote:
Total RNA was extracted from cells in an acidic condition (pH 4.5) to maintain the aminoacylated state of tRNAs as described (Parker et al., Cell Systems 2020). Cell cultures at the appropriate OD were mixed at a 1:1 volume ratio with 10% TCA and incubated on ice for 10 min ...
-
No products found
because this supplier's products are not listed.
Jason A. Rothman, et al.,
bioRxiv - Systems Biology 2024
Quote:
We analyzed uric acid with the Salimetrics Salivary Uric Acid Assay kit (Salimetrics, Carlsbad, CA, USA). We mixed 10 uL of sample with 190 uL of uric acid reagent in duplicate following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Jose Aguiar-Cervera, et al.,
bioRxiv - Microbiology 2024
Quote:
... The yeast strains were revived from –80 °C in YPD broth and arranged in 3×4 squares (Fig. S1A) on SBS PlusPlates containing solidified 12 °Bx wort and YPD using the PIXL (Singer Instruments, UK) robotic platform ...
-
No products found
because this supplier's products are not listed.
Shivanand Hegde, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 min 3% bleach+0.01% Coverage Plus NPD (Steris Corp.), 5 min in 70% ethanol then rinsed three times in sterile water ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... or 4-dimethylaminophenylazophenyl-4’-maleimide (DABMI, Setareh Biotech). After labeling ...
-
No products found
because this supplier's products are not listed.
Jack P. K. Bravo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and nanoPOP-6 polymer (Molecular Cloning Laboratories). The oven temperature was set to 65°C ...
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... with 14.16□g of HEPES acid (STREM Chemicals) and 16.65 g of HEPES sodium salt (STREM Chemicals) ...
-
No products found
because this supplier's products are not listed.
Doris Krauter, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Western Blots were incubated overnight at 4 °C in primary antibodies against PMP22 (1:1000, Assay Biotech), PTEN (1:1000 ...
-
No products found
because this supplier's products are not listed.
Robert L. McPherson, et al.,
bioRxiv - Biochemistry 2022
Quote:
... or YCFAC medium (Yeast Casitone Fatty Acids Agar with Carbohydrates, Anaerobe Systems). Liquid cultures were established for each isolate through the inoculation of a single colony into 5-10 mL of media ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Ahmed Ali, et al.,
bioRxiv - Biophysics 2023
Quote:
... and sequentially in 1:3 dilution steps added to the wells of PEG-BSA coated ELISA plates (PBSA20PL, Life Diagnostics, Inc.) The plates were incubated for 2 h at RT to allow antibody binding ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Shabnam Ghiasvand, et al.,
bioRxiv - Neuroscience 2022
Quote:
6-well tissue culture plates were transferred to an interface chamber (Bioscience Tools) connected to a temperature controller maintaining temperature at 37 °C and a blood gas providing 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... three sections for each brain electroporated at E14.5 with pUB6-TOM and pSilencer-U6-scram (number of brains, n = 4) or pSilencer-U6-miR-137 (number of brains, n = 4) and injected with retrobeads (Lumafluor) at P9 ...
-
No products found
because this supplier's products are not listed.
Zachery Mielko, et al.,
bioRxiv - Biophysics 2022
Quote:
... Primary antibodies for CPD and 6-4PP photoproducts were purchased from Cosmo Bio USA (Catalog numbers ...
-
No products found
because this supplier's products are not listed.
Ionel Sandovici, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Insulin levels in acid–ethanol supernatants were measured using ELISA kits (Mercodia – 10-1247-01). Total pancreas insulin content (pmol/L ...
-
No products found
because this supplier's products are not listed.
Yuichiro Honda, et al.,
bioRxiv - Pathology 2020
Quote:
... The sections were blocked with 5% bovine serum albumin in PBS for 60 min and incubated overnight at 4°C with a mouse anti-CD-11b primary antibody (1:2000; BMA Biomedicals, Augst, Switzerland) or a rabbit polyclonal anti-dystrophin primary antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Kelly L. Buchanan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or the sweet taste receptor inhibitor (T1R2/3) gurmarin (Peptides International) were dissolved into 1M sucrose ...
-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Sudhir Kumar, et al.,
bioRxiv - Microbiology 2021
Quote:
... Gametocyte cultures were set up in 6 well plates using O+ human RBCs (Valley Biomedical, VA, US) and O+ human serum (Interstate Blood Bank ...
-
No products found
because this supplier's products are not listed.
Jasmin A. Schäfer, et al.,
bioRxiv - Cell Biology 2019
Quote:
... folic acid and riboflavin (Formedium, Norfolk, UK) and 0.2 µg/ml rapamycin in 96-well glass bottom plates (Brooks Life Sciences, Chelmsford, Massachusetts) coated with concanavalin A ...
-
No products found
because this supplier's products are not listed.
Kira Cozzolino, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Nuclear run-ons were performed for 3 minutes at 37°C on a Groovin’ Tubes thermoshaker (Boekel Scientific, 270500), on a mixture of 10 million human and 100,000 Drosophila melanogaster nuclei per replicate ...
-
No products found
because this supplier's products are not listed.
M. Tomasi, et al.,
bioRxiv - Microbiology 2021
Quote:
... followed by an overnight incubation at +4°C with anti-OVA257-264 Dextramer PE conjugate (SIINFEKL, IMMUDEX, Virum Denmark) diluted 1:30 in blocking solution ...
-
No products found
because this supplier's products are not listed.
Akash D. Chakraborty, et al.,
bioRxiv - Physiology 2023
Quote:
... SERCA2 (1:5000, Badrilla), CSQ2 (1:3000 ...
-
No products found
because this supplier's products are not listed.
Aviad Ben-Shmuel, et al.,
bioRxiv - Immunology 2021
Quote:
... Rabbit anti-pSHP-1 (S591) (ECM Biosciences), Rabbit anti-pPLCγ1 (Y783 ...
-
No products found
because this supplier's products are not listed.
Linglei Jiang, et al.,
bioRxiv - Immunology 2022
Quote:
... IgA (1:250, Brookwood Biomedical, AL, USA) or IgM (1:250 ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... panBAG-1 (human, rabbit monoclonal, RM356, RevMAb), panBAG-1 (mouse ...
-
No products found
because this supplier's products are not listed.
Hiroshi Yamaguchi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Methylated gold nanoparticles (final 1:2 dilution; CGM2K-15-25, Cytodiagnostics) were added as fiducial markers ...