-
No products found
because this supplier's products are not listed.
Yusuke Nishimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
Akt1/2/3 inhibitor MK-2206 dihydrochloride (ApexBio, A3010), Rapamycin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Mohit Rajabhoj, et al.,
bioRxiv - Plant Biology 2023
Quote:
... from 2 to 3-day-old WT and mea-1-/-;dme-2-/- seedlings using NucleoSpin® Plant II (MACHEREY-NAGEL). 200 ng of DNA was subjected to fragmentation using ultrasonicator (Covaris ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...
-
No products found
because this supplier's products are not listed.
Jing Jia, et al.,
bioRxiv - Neuroscience 2020
Quote:
FEF neurons were extracellularly recorded by using single-unit tungsten microelectrodes (FHC; tip diameter 3 μm, impedance 1–2 MΩ). A hydraulic microdrive (FHC ...
-
No products found
because this supplier's products are not listed.
Esmi Lau Zajaczkowski, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
No products found
because this supplier's products are not listed.
Rowena Hill, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... 2–5.5 µg of each sample was sheared using the Megaruptor 3 instrument (Diagenode, Liege, Belgium) at 18-20ng/µl and speed setting 31 ...
-
No products found
because this supplier's products are not listed.
Chhiring Lama, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 6-diamidino-2-phenylindole (Spectral DAPI, Akoya Biosciences) was applied per provided protocols to label nuclei ...
-
No products found
because this supplier's products are not listed.
Ayijiang Yisimayi, et al.,
bioRxiv - Immunology 2023
Quote:
ELISA assays were conducted by pre-coating ELISA plates with RBD (SARS-CoV-2 wild type, SARS-CoV-2 BA.1, SARS-CoV-2 BA.2 RBD, Sino Biological) at concentrations of 0.03 μg ml−1 and 1 μg ml−1 in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Ami Patel, et al.,
bioRxiv - Immunology 2020
Quote:
... or 3) anti-CD3 positive control (Mabtech, 1:1000 dilution). All samples were plated in triplicate ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) was purchased from Chem-Impex. Falcon cell strainer tubes were purchased from Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Ding Xiong, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 to 3×106 cells were seeded in one 35mm glass bottom culture dishes (MatTek) after transient transfection ...
-
No products found
because this supplier's products are not listed.
Lena H. Nguyen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... p-4E-BP1/2/3-Thr45 (Bioss Antibodies bs-6421R, 1:200, 1:500), anti-HCN4 (Alomone Labs APC-052 ...
-
No products found
because this supplier's products are not listed.
Shelly J. Robertson, et al.,
bioRxiv - Microbiology 2023
Quote:
Sera were collected from SARS-CoV-2-infected mice at 3 and 6 dpi by centrifugation of whole blood in GelZ serum separation tubes (Sarstedt). BAL samples were recovered by insufflation of lungs with 1 ml sterile PBS followed by aspiration to collect ∼0.5ml volume of fluid ...
-
No products found
because this supplier's products are not listed.
Jaeseong Goh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and B103 cells were incubated in 6 mL of medium containing 0.5% 3-(4,5-dimethylthiazol-2-yl)-2,5-di-phenyltetrazolium bromide (MTT; Amresco Inc., OH, USA) at 37 °C for 90 min and ASCs for 3 h ...
-
No products found
because this supplier's products are not listed.
Ambre Guillory, et al.,
bioRxiv - Plant Biology 2024
Quote:
... root samples were incubated overnight in the dark at 28 °C in Z-buffer containing 2 mM Magenta-Gal (5-bromo-6-chloro-3-indoxyl-b-D-galactopyranoside; B7200; Biosynth) or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside ...
-
No products found
because this supplier's products are not listed.
Subhrangshu Guhathakurta, et al.,
bioRxiv - Neuroscience 2020
Quote:
... from days 1-6 and 3-μM CHIR99021(Reprocell, 04-0004) from days 3-12 ...
-
No products found
because this supplier's products are not listed.
Ziqiang Lin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were incubated in Histoclear (2×3 min; National Diagnostics, USA) and cover-slipped with mounting medium (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Ida Paciello, et al.,
bioRxiv - Immunology 2024
Quote:
... 3 µg ml-1 of SARS-CoV-2 subunits diluted in carbonate-bicarbonate buffer (E107, Bethyl Laboratories), were coated in 384-well plates (microplate clear ...
-
No products found
because this supplier's products are not listed.
C Cintas, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Human pancreatic cell lines (Capan-1, BxPC-3, PANC-1, MIA PaCa-2) came from American Type Culture Collection (ATCC), human acute myeloid leukemia cell line (MOLM4 ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
... HAPECs (passage 2-6, ScienCell, Carlsbad, CA) were incubated with 0.1 ng/mL interleukin-1 beta (IL-1β) ...
-
No products found
because this supplier's products are not listed.
Erika Riederer, et al.,
bioRxiv - Biophysics 2021
Quote:
... the GltPh proteins were reduced with 500 µM tris(2-carboxy-ethyl) phosphine (TCEP, Gold Biotechnology) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... cleaved-caspase 3 (1:1000, Bioworld), Pro-Caspase 3 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Bradley C. Paasch, et al.,
bioRxiv - Plant Biology 2023
Quote:
... blocked in 3% milk + 2% BSA and immunoblotted overnight at 4 °C with antibodies specific to Arabidopsis FLS2 (Agrisera), BAK1 (Agrisera) ...
-
No products found
because this supplier's products are not listed.
Jimin Yoon, et al.,
bioRxiv - Biophysics 2023
Quote:
... the cells were stained with 200 μL of 5 mg/mL solution of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) stain (Research Products International) in PBS ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Steven R. Talbot, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... the cecum was 2/3 ligated (Nylon Monofilament Suture 6/0, Fine Science Tools GmbH, Heidelberg, Germany) distal to the ileocecal valve ...
-
No products found
because this supplier's products are not listed.
Hannah Fitzgerald, et al.,
bioRxiv - Physiology 2023
Quote:
... and anti-Galectin 3 (Mac-2) (Cedarlane Cat# CL8942AP). For this co-stain ...
-
6 micro-well glass bottom plate with #1 cover glass(0.13-0.16mm), micro-well size 14mm, with...
Cat# P06-14-1-N,
20/case, $178.00
Ask
Taemoon Chung, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3×105 MIA PaCa-2/GemLuc cells were either plated day -1 on a black-walled 6 well plate (Cellvis, Mountain View, CA) or a clear bottom 6 well plate (Corning ...
-
No products found
because this supplier's products are not listed.
Paula Bracco, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 3-deoxydehydroepiandrostendione (10) and 5α-androstan-3-one (11) were purchased from Steraloids Inc ...
-
No products found
because this supplier's products are not listed.
Rafaela Muniz de Queiroz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-integrin alpha-3 (cat#A02902) and anti-integrin alpha-2 (cat#A01933-2) were purchased from Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Dario Campagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The solution was perfused at a flow rate of 2-3 ml/min with a peristaltic pump (PPS2, MultiChannel Systems or Minipuls 3, Gilson) and temperature was kept at 32-34°C ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Ranjan Sengupta, et al.,
bioRxiv - Cell Biology 2019
Quote:
Cell pellets (2-3 μl) were loaded onto copper membrane carriers (1mm x 0.5 mm; Ted Pella Inc.) and cryofixed using the EM PACT2 high pressure freezer (Leica) ...
-
No products found
because this supplier's products are not listed.
Natalya Leneva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... with 3 mol% of dipalmitoyl-phosphatidylinositol-3-phosphate (PI(3)P) (Echelon Biosciences) were prepared at a lipid concentration of 0.5 mg/ml in Buffer A by extrusion through a 0.4 μm polycarbonate filter (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Alexandra A.M. Fischer, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... ACC 635) and U2OS 2-6-3[67] cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM, PAN Biotech, catalog no. P04-03550) completed with 10% (v/v ...
-
No products found
because this supplier's products are not listed.
Christophe Caillat, et al.,
bioRxiv - Microbiology 2020
Quote:
... 100 mM NaCl and 1% CHAPS (3-[(3-cholamidopropyl) diméthylammonio]-1-propanesulfonate (Euromedex). The supernatant was cleared by centrifugation at 53 000 g for 30 min ...
-
No products found
because this supplier's products are not listed.
Renée M. van der Sluis, et al.,
bioRxiv - Immunology 2021
Quote:
... were added to Calu-3 cells in 50 μL PBS and antibodies neutralizing IFNα (mouse anti-human IFN alpha antibody, clone MMHA-2, PBL Assay Science Cat#21100-2) or isotype control (Purified mouse IgG1 ...
-
No products found
because this supplier's products are not listed.
Alexey Kolodkin, et al.,
bioRxiv - Systems Biology 2019
Quote:
... PC12 (2×105 cells/well) were plated in 6-well plates (EuroClone) pre-coated with poly-L-lysine (0.1 mg/ml) ...
-
No products found
because this supplier's products are not listed.
Anja Kopp, et al.,
bioRxiv - Biochemistry 2023
Quote:
Screening of crystallization conditions for wild type GSDMD and GSDMDΔ184-194/Δ247-272 in complex with nanobodies VHHGSDMD-1 to VHHGSDMD-6 and the combination of VHHGSDMD-2 plus VHHGSDMD-6 was performed using commercial kits from Molecular Dimensions (Maumee, OH, USA) and Jena Bioscience (Jena ...
-
No products found
because this supplier's products are not listed.
Andrea Mohr, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... multimeric FasL and anti-APO-1-3 from AdipoGen Life Sciences (San Diego ...
-
No products found
because this supplier's products are not listed.
Robert Rauschkolb, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... from Mediterranean and temperate species had germinated we transplanted up to 20 seedlings each into 9 × 9 cm pots (one plant per pot) with a 3:1 mixture of potting soil (Einheitserde®, BioLine, Topfsubstrat Öko torffrei) and sand (0-2 mm play sand ...
-
No products found
because this supplier's products are not listed.
Donatas Repecka, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and MultiQuant 3 (Sciex) was used for analysis and quantitation of results ...
-
No products found
because this supplier's products are not listed.
Abigail H. Cleveland, et al.,
bioRxiv - Neuroscience 2021
Quote:
... cleaved-Caspase 3 (cC3) diluted 1:400 (Biocare Medical, #CP229C), glial fibrillary acidic protein (GFAP ...
-
No products found
because this supplier's products are not listed.
Hui Zhang, et al.,
bioRxiv - Microbiology 2021
Quote:
One ug/ml His-tagged spike RBD protein of SARS-CoV-2 (SPD-C52H3, Acrobiosystems) were immobilized onto 96-well plates (9018 ...
-
No products found
because this supplier's products are not listed.
Samantha J. Ziegler, et al.,
bioRxiv - Biophysics 2024
Quote:
... Grids were blotted for 3 seconds using a CP3 Cryoplunge 3 (Gatan Ametek Inc.) before being plunged into liquid ethane held at –168 °C ...