1 - 50 of 729
suppliers found for
6' ETHYL SPIRO 1 3 DIOXANE 2 3' INDOLIN 2' ONE
» view 10000+ matched products-
BOC Sciences Sponsored
Cat# 864685-12-1, Inquire Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... 1% 2-ethyl-3-methylpyrazine (Sigma W315508), 1% 2,5-dimethylpyrazine (Sigma 17542015) ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco). -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 1-[2-(4-Methoxyphenyl)-2-[3-(4-methoxyphenyl)propoxy]ethyl-1H-imidazole hydrochloride (SKF-96365; 1147, Tocris) in ddH20 ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Pathology 2022Quote: ... and Proteasome 20S alpha 1+2+3+5+6+7 (Abcam, ab22674). After washing with TBS-T (200 mM Tris (Merck) ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: Planar lipid bilayers were prepared by painting a 0.2 mm hole drilled in a Teflon cup with a phospholipid solution in n-decane containing a 3:1 mixture of 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphoethanolamine and 1-palmitoyl-2-oleoylsn-glycerol-3-phosphoserine (Avanti Polar Lipids). The lipid bilayer separated 1.0 ml of solution (cis side ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019Quote: ... AKT 1/2/3 (Santa Cruz), Slit2 (Abcam ab134166 ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... Smad 2/3 (1:1000; Cell Signaling; #8685S), P-Smad 1/5/8 (1:1000 ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) (Promega, Cat. No. G109C) cell viability assay was performed ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2017, published in Clinical Epigenetics doi: 10.1186/s13148-017-0391-xQuote: ... SiRNAs against Nipbl (Nipbl-1: 5’-GTGGTCGTTACCGAAACCGAA-3’; Nipbl-2: 5’-AAGGCAGTACTTAGACTTTAA-3’) and Rad21 (5’-CTCGAGAATGGTAATTGTATA-3’) were made by Qiagen. AllStars Negative Control siRNA was obtained from Qiagen. -
Addgene
No products found because this supplier's products are not listed.Cited in USP22 controls type III interferon signaling and SARS-CoV-2 infection through activation of STINGbioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2022Quote: ... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019, published in Matrix Biology doi: 10.1016/j.matbio.2019.12.003Quote: ... the collagenase inhibitor Ilomastat ((R)-N′-Hydroxy-N-[(S)-2-indol-3-yl-1-(methylcarbamoyl)ethyl]-2-isobutylsuccinamide) (25μM, CC1010, Merck Millipore) or a combination of both ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.Cited in An RNA Degradation Complex Required for Spreading and Epigenetic Inheritance of HeterochromatinbioRxiv - Molecular Biology 2019Quote: ... treated with 3% ethyl methanesulfonate (EMS)(Winston ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... mice used were 2-3-month-old C57BL/6 (Jackson Laboratories, Bar Harbor, ME, #000664) at the time of injury ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in Clinical Cancer Research doi: 10.1158/1078-0432.CCR-19-1667Quote: ... and maintained in culture for a total of approximately 2-3 months in DMEM supplemented with 1 ng/mL IL-3 (Peprotech). Mycoplasma testing was not performed ... -
Charles River Labs
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ... -
Polysciences
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Frontiers in Neuroscience doi: 10.3389/fnins.2019.00201Quote: ... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ... -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-[3-(dimethylamino)propyl]-carbodiimide (EDC) was purchased from TCI EUROPE (Eschborn ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ... -
Lonza
No products found because this supplier's products are not listed.Cited in HMGB1 coordinates SASP-related chromatin folding and RNA homeostasis on the path to senescencebioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019, published in Molecular Pharmacology doi: 10.1124/mol.119.117069Quote: ... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... rat anti-mouse Mac-2 (Galectin-3, 125402, Biolegend) for myeloid cells (Ho and Springer 1982) ... -
Greiner
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: ... and subsequently diluted 1:125 in culture medium and added to quadrant 1, 2 and 3 (respectively for 10mM, 1mM and 0.1mM stock plates) of deepwell 384-well plates (#781271, Greiner Bio-One). DMSO-stock solutions of control molecules (100% DMSO as negative control and as positive controls we included 1000-times concentrated docetaxel [30uM] ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2018Quote: MCF7 cells were transfected with siRNA targeting nesprin-1, nesprin-2, nesprin-3, or nesprin-4 genes (Sangon Biotech, Shanghai, China) using FuGENE 6 Transfection Reagent (Roche Diagnostics, Basel, Switzerland). -
anatrace
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: ... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ... -
Worthington Biochemical
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...Cat# LS004183, 5 gm, $825.0 AskbioRxiv - Immunology 2018, published in The Journal of Immunology doi: 10.4049/jimmunol.1800586Quote: ... 3 µg/ml L-(tosylamido-2-phenyl) ethyl chloromethyl ketone (TPCK)-treated trypsin (Worthington Biochemical, Lakewood NJ) and 25 mM HEPES (Quality Biological) ... -
Phenomenex
No products found because this supplier's products are not listed.Cited in FlashPack: Fast and simple preparation of ultra-high performance capillary columns for LC-MSbioRxiv - Biochemistry 2018, published in Molecular & Cellular Proteomics doi: 10.1074/mcp.tir118.000953Quote: ... Luna 2 C18 3 μm (Phenomenex), Zorbax SB-C18 1.8 μm (Agilent) ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2018, published in GigaScience doi: 10.1093/gigascience/giy126Quote: ... we used microscopy system 3 (Leica DMi8, Table 2). -
VWR
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2018, published in Antimicrobial Agents and Chemotherapy doi: 10.1128/aac.02410-18Quote: ... while 2-phenyl-1,2-benzisoselenazol-3(2H)-one (ebselen, Eb, PubChem SID 856002) and glucosamine hydrochloride were obtained from VWR International (West Chester ... -
Quantifoil Micro Tools
No products found because this supplier's products are not listed.Cited in Contour, a semi-automated segmentation and quantitation tool for cryo-soft-X-ray tomographybioRxiv - Cell Biology 2021Quote: 3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ... -
R&D Systems
No products found because this supplier's products are not listed.Cited in DNAJB1-PRKACA in HEK293T cells induces LINC00473 overexpression that depends on PKA signalingbioRxiv - Cancer Biology 2021Quote: Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ... -
Jena Bioscience
No products found because this supplier's products are not listed.Cited in Mechanism of actin-dependent activation of nucleotidyl cyclase toxins from bacterial human pathogensbioRxiv - Biochemistry 2021Quote: ... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ... -
GE Life Sciences
No products found because this supplier's products are not listed.Cited in Structures of PKA-phospholamban complexes reveal a mechanism of familial dilated cardiomyopathybioRxiv - Biochemistry 2021Quote: ... PKAc was immobilized via standard N-hydroxysuccinimide (NHS) / 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) amine coupling on a CM5 (carboxyl methyl dextran) sensor chip (GE Healthcare). Before covalent immobilization of PKAc ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: ... The 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one (PD98059, MEK inhibitor) and STAT3 inhibitor VI were from Calbiochem (Darmstadt, Germany). The EGF was from Millipore (Billerica ... -
3M
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 2 and 3 (3M and 6M, mEPSCs), 2 and 6 (3M and 6M ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ... -
Cayman Chemical
No products found because this supplier's products are not listed.Cited in Influenza A matrix protein M1 induces lipid membrane deformation via protein multimerizationbioRxiv - Biophysics 2019, published in Bioscience Reports doi: 10.1042/BSR20191024Quote: ... 2-(4-(3-(4-acetyl-3-hydroxy-2-propylphenoxy) propoxy) phenoxy acetic acid (PHE) was purchased from Cayman Chemical (Ann Arbor, MI, USA). 10-fold concentrated phosphate buffer (PBS ... -
Enamine
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... the covalent DsbB inhibitor 4,5-dichloro-2-(2-chlorobenzyl)pyridazin-3-one (final concentration of 50 μM) (Enamine) was added to the medium ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Cell Reports doi: 10.1016/j.celrep.2020.107538Quote: ... with medium changes every 2-3 days and passages 1-2 times per week using ReLeSR (Stem Cell Technologies). Heteroplasmy levels were regularly measured to insure they were retained across passage numbers ... -
World Precision Instruments
No products found because this supplier's products are not listed.Cited in Sensory Stimulation-Induced Astrocytic Calcium Signaling in Electrically Silent Ischemic PenumbrabioRxiv - Neuroscience 2019, published in Frontiers in Aging Neuroscience doi: 10.3389/fnagi.2019.00223Quote: A glass micropipette (1–3 MΩ impedance; 2-μm tip; World Precision Instruments) was connected to a pneumatic injector (3–20 PSI ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... TSA® Plus fluorophore for channel 2 (cyanine 3, PerkinElmer; 1:1000; 30 min), HRP blocker (15 min) ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ... -
Carbosynth
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... Samples for Immunostaining were fixed in 2% PFA or 4% 1-ethyl-3 (3-dimethylaminopropyl)-carbodiimide (EDAC, Carbosynth, Berkshire, UK). The fixed brains were dissected to enhance antigen presentation and to improve image quality. -
Olympus
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in Nature Methods doi: 10.1038/s41592-019-0581-xQuote: ... Wide-field images (Fig.1, 2, 3, 5, 6) were acquired with a 4× objective (Olympus XLFluor 4x/340a); high-resolution images (Fig ... -
Toronto Research Chemical
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019Quote: ... 2-hydroxy-3-methylanthraquinone (13) and 2-hydroxy-1-methylanthraquinone (14) were obtained from Toronto Research Chemical, ON ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ... -
Alfa Aesar
No products found because this supplier's products are not listed.Cited in Controlled Fluorescent Labelling of Metal Oxide Nanoparticles for Artefact-free Live Cell MicroscopybioRxiv - Biophysics 2021Quote: ... 3-(2-aminoethylamino)propyltrimethoxysilane (AEAPMS, Alfa Aesar), lacy carbon film supported by a 300-mesh copper grid (Ted Pella ...