1 - 50 of 501
suppliers found for
5 nitrobenzothiazole
» view 10000+ matched products-
BOC Sciences Sponsored
Cat# 2942-07-6, Inquire Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in Blood Cancer Discovery doi: 10.1158/0008-5472.BCD-19-0039Quote: ... 5 μM 5-Aza-2′-deoxycytidine (5-Aza; Sigma), 250-500 nM CpG-scramble ... -
Thermo Fisher
No products found because this supplier's products are not listed.Cited in 4D live-cell imaging of microgametogenesis in the human malaria parasite Plasmodium falciparumbioRxiv - Microbiology 2021Quote: ... 5% human serum and 5% AlbuMAX-II (Gibco)) was replaced daily until reaching maturity at day 14-post induction ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... m7G(5′)ppp(5′)G (NEB, #S1404S) and m7G(5′)ppp(5′)A (NEB ... -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... 5-nonyloxytryptamine oxalate (5-NT) (Tocris, Bristol, United Kingdom) was diluted to a 5mM stock concentration in DMSO (Merck) ... -
Phenomenex
No products found because this supplier's products are not listed.bioRxiv - Systems Biology 2019, published in Heliyon doi: 10.1016/j.heliyon.2019.e02899Quote: ... 5 µm (Phenomenex) column ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... 5 ng/ml IL-5 (Biolegend; 581504), and 20 ng/ml IL-2 (Biolegend ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ... -
Corning
No products found because this supplier's products are not listed.Cited in Nobiletin Affects Circadian Rhythms and Oncogenic Characteristics in a Cell-Dependent MannerbioRxiv - Cancer Biology 2020, published in PLOS ONE doi: 10.1371/journal.pone.0236315Quote: ... 5% FBS (Corning), 1% HEPES (HyClone) ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... 5 μl 5× Buffer (Promega), 2 μl MgCl2 (25mM) ... -
Lucigen
No products found because this supplier's products are not listed.Cited in Mapping the complex transcriptional landscape of the phytopathogenic bacterium Dickeya dadantiibioRxiv - Microbiology 2021Quote: ... 5’PPP structures were then converted into 5’P ends using RNA 5’ Polyphosphatase (5’PP, Epicentre), to which RNA adapters were ligated ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... IL-5 (5 ng/ml, R&D Systems), TGF-β (3 ng/ml ... -
Biotek
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2022Quote: ... 5 (BioTek). OD600nm readings were taken every hour and growth curves were plotted using GraphPad Prism 9. -
Merck
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: ... 5 mM MgCl2 and 5 KU Benzonase nuclease (Merck Millipore) for 30 mins at 4 °C ... -
Roche
No products found because this supplier's products are not listed.Cited in Enhancers regulate 3′ end processing activity to control expression of alternative 3′UTR isoformsbioRxiv - Biochemistry 2021Quote: ... 5’ RACE was performed with the 5’ RACE kit (Roche) using gene-specific reverse primers ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... clone 5 (BD Transduction Laboratories ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... BSA 5% (VWR) and fluorescently labelled antibodies at proper concentration ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... α5 (Abcam, ab175195), β2 (Abcam ... -
TriLink BioTechnologies
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2021Quote: ... pseudouridine-5′-triphosphate (ΨTP) and 5-methylcytidine-5′-triphosphate (m5CTP) (both from TriLink BioTechnologies) were used instead of natural UTP and CTP ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... LPS (5 µg/ml) or LPS (5 µg/ml) + concanavalin A (5 μg/ml; InvivoGen) were employed as control stimulants for splenocytes and isolated cells respectively. -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... 5 μg/ml insulin and 5 μM rosiglitazone (Cayman Chemical) in DMEM:F12 containing 10% FBS ... -
Zymo Research
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2021Quote: ... Selection for pyrF mutations was performed with 5-fluoroorotic acid (5-FOA, Zymo Research, part number F9001-5) at a final concentration of 0.5 mg/ml ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2018, published in Cell Reports doi: 10.1016/j.celrep.2018.05.077Quote: ... BrU (-5-Bromouridine cat.no. CAS 957–75–5 Santa Cruz Biotechnology) was added to a final concentration of 2 mM to the media and cells were incubated at normal growth conditions for 15 minutes (pulse) ... -
GE Life Sciences
No products found because this supplier's products are not listed.Cited in It takes a dimer to tango: Oligomeric small heat-shock proteins dissociate to capture substratebioRxiv - Molecular Biology 2018, published in Journal of Biological Chemistry doi: 10.1074/jbc.ra118.005421Quote: ... 5 mM NaCl using 5 mL HiTrap desalting columns (GE Healthcare). The buffer included 0.5 mM TCEP as reducing agent for proteins TaV144C ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Immunology 2017, published in European Journal of Immunology doi: 10.1002/eji.201847498Quote: ... gRNAs composed of 5’-CACCGAAGACATACACCACCACGG-3’ annealed with 5’-AAACCCGTGGTGGTGTATGTCTTC −3’ and 5’-CACCGCATCAGTCCTCCAGCCAG −3’ annealed with 5’-AAACCTGGCTGGAGGACTGATGC −3’ were cloned into the pX330 vector (Addgene), amplified by PCR and transcribed using the Megashortscript T7 transcription kit (Life Technologies) ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2017, published in Clinical Epigenetics doi: 10.1186/s13148-017-0391-xQuote: ... SiRNAs against Nipbl (Nipbl-1: 5’-GTGGTCGTTACCGAAACCGAA-3’; Nipbl-2: 5’-AAGGCAGTACTTAGACTTTAA-3’) and Rad21 (5’-CTCGAGAATGGTAATTGTATA-3’) were made by Qiagen. AllStars Negative Control siRNA was obtained from Qiagen. -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in Nature Neuroscience doi: 10.1038/s41593-018-0204-3Quote: ... and Cyanine 5 (PerkinElmer) individually ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Pathology 2020Quote: ... Rab 5 (Cell Signaling, #3547S) and N-Cadherin (BD Transduction Labs ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2021Quote: ... Peptides were first loaded onto a C18 trap column (5 µm, 5 × 0.3 mm, Agilent Technologies) and then eluted into a C18 analytical column (75 μm × 150 mm ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Genomics 2018Quote: T1 5’ (Sp6 promoter, GFP coding sequence, and 5’ Illumina adaptor) GCTTGATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGGATCCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCC ATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGT TCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACAT GAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCC GAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGT ACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAG CGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTG AGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTCCG GACTCAGATCTAAGCTGAACCCTCCTGATGAGAGTGGCCCCGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTGACTCGAGGATCTACACTCTTTCCC TACACGACGCTCTTCCGATCT -
Jackson ImmunoResearch
No products found because this supplier's products are not listed.bioRxiv - Genomics 2021Quote: ... 5% normal donkey serum and 5% normal goat serum (Jackson Immunoresearch) for 30 min at room temperature ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... or 1-NMPP1 (5 μM, Calbiochem; 5 mM stock in dimethylsulfoxide) were added to the medium at the time of prophase exit ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019Quote: ... 5 ng/ml FGF7 (Peprotech), 10ng/ml Amphiregulin (Peprotech) ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019Quote: ... 5 mM L-Glutamine (Lonza), and 1% penicillin and streptomycin (Lonza ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Molecular Brain doi: 10.1186/s13041-020-00603-7Quote: ... dispase (5 U/ml) (Stemcell Technologies), DNase I (2000 U/ml ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... blocked with 5% BSA/5% normal goat serum (Vector Laboratories) in PBS-T ... -
Atlanta Biologicals
No products found because this supplier's products are not listed.Cited in The N-cadherin interactome in primary cardiomyocytes as defined by quantitative proximity proteomicsbioRxiv - Cell Biology 2018, published in Journal of Cell Science doi: 10.1242/jcs.221606Quote: ... 5% FBS (Atlanta Biologicals) and 1% penicillin-streptomycin (Thermo Fisher Scientific) ... -
Gold Biotechnology
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: Adenosine-5’-triphosphate (Goldbio, Cat. # A-081-5) -
Eppendorf
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... and 5 % CO2 (Eppendorf). Jurkat CD4-KO cells were derived from wild-type Jurkat T cells (clone E6 ... -
Eurogentec
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... siRNA 2 5’ GCCCUAUCCCUUUACGUCA (Eurogentec). Dharmacon ONTarget plus SMARTpool ... -
Biotium Inc.
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: ... and 5 μL of 5 μg/mL Propidium Iodide (Biotium) for cell death detection ... -
Diagenode
No products found because this supplier's products are not listed.Cited in The deubiquitinase Usp9x regulates PRC2-mediated chromatin reprogramming during mouse developmentbioRxiv - Molecular Biology 2020Quote: ... 5 min total (Diagenode). -
ApexBio
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2022Quote: ... or 5-methoxyuridine 5’-triphosphate (5moUTP, APExBIO), and cytidine 5’-triphosphate (CTP ... -
Selleck Chemicals
5-Hydroxytryptophan (5-HTP, NSC-92523), also known as oxitriptan (INN), is a naturally occurring...Cat# S2374, SKU# S2374-10mM/1mL, 10mM/1mL, $90.00 AskbioRxiv - Cancer Biology 2021Quote: ... 5-10 µM (Selleck Chemicals); RACi ... -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.Cited in Treatment of wound infections in a mouse model using Zn2+-releasing phage bound to gold nanorodsbioRxiv - Bioengineering 2022Quote: ... 5-bromosalicylic acid (5-BAA) (>98.0%; TCI), isopropyl β-D-1- thiogalactopyranoside (IPTG ... -
Polysciences
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2022Quote: ... Transporter 5™ reagent (Polysciences, Inc, Cat #26008-5) was used to transfect parental HEK293T/17 cells ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ... -
Jena Bioscience
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2020Quote: ... of λ-DNA using the following primers: 5’-CGAACTCTTCAAATTCTTCTTCCA-3’ and 5’-GATTGCTCTTCTGTAAGGTTTTG-3’ with a 5:1 ratio of dTTP:biotin-11-dUTP (Jena Bioscience). Similarly ... -
Spherotech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... we used 5 μm streptavidin-coated polystyrene bead (Spherotech #VP-60-5). We used 1,1’-carbonyldiimidazole in DMSO based system as described by Tam et al ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... Sections were permeabilized and blocked for 1h at room temperature in 0.3% Triton (Sigma-Aldrich)/5% goat serum (Jackson Laboratories), then stained overnight at 4°C with a primary antibody against microglia (Iba1 ...