-
No products found
because this supplier's products are not listed.
Nathan Jariwala, et al.,
bioRxiv - Cell Biology 2023
Quote:
... hyaluronic acid (Corgenix 029-001) and decorin (R&D Systems DY143 ...
-
No products found
because this supplier's products are not listed.
Peter M. Masschelin, et al.,
bioRxiv - Physiology 2022
Quote:
... and serum-free fatty acids (#sfa-1; Zen-Bio).
-
No products found
because this supplier's products are not listed.
Alexander C. Whitebirch, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Diazepam (5 mg/kg, i.p.; McKesson #636203) was administered 1 hr after SE onset to curtail seizures ...
-
No products found
because this supplier's products are not listed.
Yubao Fan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or 5% donkey serum (Abbkine, Wuhan, CN.) for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Kilea Ward, Hongmei Li-Byarlay,
bioRxiv - Physiology 2021
Quote:
... The assay was conducted using the OXItek™ Thiobarbituric Acid Reactive Substances (TBARS) Assay Kit (ZeptoMetrix Corp). The head of each bee was flash-frozen in liquid nitrogen and immediately pulverized in a 1.5 mL microcentrifuge tube with a sterile plastic pestle ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... pICln guide 2 was acquired from Cellecta in vector pRSG17 ...
-
No products found
because this supplier's products are not listed.
Caroline S. Cencer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... CL4 and CACO-2BBE cells were grown to n days post-confluent (DPC) on acid-washed 22×22 mm #1.5H coverslips (Globe Scientific) in a 6-well plate to a time point with apical polarity representative of their native tissue ...
-
No products found
because this supplier's products are not listed.
Richard J. R. Kelwick, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... A549 EVs (100 μg; #HBM-A549-100/5, HansaBioMed, Tallinn, Estonia) were lysed and processed according to the manufacturer’s guidelines and the developed dot blot array was imaged using a ChemiDoc imaging system (Bio-Rad Laboratories Inc. ...
-
No products found
because this supplier's products are not listed.
Xiaona Chen, et al.,
bioRxiv - Cell Biology 2020
Quote:
... gastrocnemius and quadriceps muscles were injected with CTX (Latoxan; 10−5 M). At the indicated time points (3- and 7-day post injury) ...
-
No products found
because this supplier's products are not listed.
Aurelie Velay, et al.,
bioRxiv - Microbiology 2020
Quote:
... ELISA anti-SARS-CoV-2 IgA and IgG (Euroimmun, Lübeck, Germany) and (2) ELISA-2: EDI™ novel coronavirus COVID-19 IgM and IgG (Epitope Diagnostics, San Diego, CA, USA). Technical characteristics of the assays are summarized in the Supplementary data (Table S1) ...
-
No products found
because this supplier's products are not listed.
Hisayoshi Kubota, et al.,
bioRxiv - Neuroscience 2022
Quote:
... sections were blocked with 5% fetal bovine serum (Nichirei Bioscience Inc., Tokyo, Japan) in PBST for 2 h and then incubated with primary antibodies in PBST at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Jonna Heldrich, et al.,
bioRxiv - Genomics 2020
Quote:
... Samples were immunoprecipitated with 2 μL of either anti-Top2 (TopoGEN, #TG2014), anti-MYC 9E11 (Abcam ...
-
No products found
because this supplier's products are not listed.
Daniel Abebayehu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... fibroblasts were cultured on 2 kPa polyacrylamide hydrogels that were purchased from Matrigen and came chemically activated ready to bind matrix proteins ...
-
No products found
because this supplier's products are not listed.
Karl Alex Hedin, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... for preventing bacterial growth and 1 g/L 5-Fluoroorotic Acid (5-FOA; Nordic BioSite) for preventing other yeast species from growing.
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Seren Hamsici, Gokhan Gunay, Handan Acar,
bioRxiv - Bioengineering 2022
Quote:
... Fmoc protected amino acids (Gyros Protein Technologies) were removed through treatment with 20% piperidine/DMF solution for 45 min (three times for 15 min ...
-
No products found
because this supplier's products are not listed.
Limin Shang, et al.,
bioRxiv - Genomics 2020
Quote:
... The PCR reactions were performed with I-5™ 2×High-Fidelity Master Mix (MCLAB, TSINGKE Biological Technology, China) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Anna Zagórska, et al.,
bioRxiv - Physiology 2020
Quote:
... in saturated aqueous solution of Picric Acid (LabChem)) ...
-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 μl of 5× TuneUp solution (NanoHelix, Korea), 1 μl of Taq-plus polymerase (NanoHelix ...
-
No products found
because this supplier's products are not listed.
Anna V. Kellner, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Tannic acid-modified 8.8 nanometer gold nanoparticles (AuNPs) were custom synthesized by Nanocomposix. Cy3B-NHS (# PA63101 ...
-
No products found
because this supplier's products are not listed.
Stephanie L. Schell, et al.,
bioRxiv - Immunology 2021
Quote:
HEp-2 slides (Antibodies Incorporated) were used according to manufacturer’s protocol with serum diluted 1:50 in 2% BSA in PBS ...
-
The PRG-2 formulation allows a very substantial reduction (<40%) in the amount of Trypsin (BAEE...
Cat# 4Z0-310,
100.0 mL, $68.0
Ask
Lorna Ewart, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 2% Culture-Boost (Cell Systems), and 10% Fetal Bovine Serum (FBS ...
-
No products found
because this supplier's products are not listed.
Anna M. O’Brien, et al.,
bioRxiv - Plant Biology 2019
Quote:
... Hydrochloric acid (36.5% to 38.0% solution in water) was purchased from Caledon Laboratories (Georgetown, Canada). Milli-Q (18.2 MΩcm ...
-
No products found
because this supplier's products are not listed.
Francis L. Fontanilla, et al.,
bioRxiv - Microbiology 2024
Quote:
HEp2 cells were seeded onto 12 mm acid-etched glass coverslips (Chemglass, CLS-1760-012) placed in 24-well plates ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
... RPA at 5 μM (ME043.1, Squarix biotechnology), MitoTracker Green at 75 nM (M7514 ...
-
No products found
because this supplier's products are not listed.
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and 5% BriClone Hybridoma Cloning Medium (QED Bioscience). One hundred units/ml penicillin ...
-
No products found
because this supplier's products are not listed.
Edward B. Irvine, et al.,
bioRxiv - Immunology 2023
Quote:
... or IgM (Life Diagnostics, clone 2C11-1-5) antibody was added at a concentration of 0.65μg/mL and incubated shaking at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Christopher J. Emig, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... SARS-CoV-2 Delta Variant pseudovirus (eEnzyme) was diluted 1:2 in DMEM complete media to a pseudoviral particle concentration of 5e7/ml ...
-
No products found
because this supplier's products are not listed.
Jaylissa Torres Robles, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Samples were boiled at 95ºC for 5 min and fractionated on 5% SDS-polyacrylamide gels with 25 nM Phos-tag reagent (Nard Institute AAL-107) and 50 μM MnCl2 as reported previously78 or by standard SDS-PAGE ...
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... the Fe with 1wt% VH precursor mixture was loaded into a custom-build consolidation die and high-pressure cold-sintered at 2.5 GPa (corresponding to 5 t for 5 mm diameter die) and RT using manual press (Carver, Wabash, IN, USA) to obtain the drug-loaded metal (Supplementary Materials ...
-
No products found
because this supplier's products are not listed.
Kazuya Ishikawa, et al.,
bioRxiv - Microbiology 2022
Quote:
... The membrane was treated with 1:1000 anti- lipoteichoic acid antibody (clone 55, Hycult Biotech, Uden, The Netherlands) and washed 3 times with phosphate buffered saline ...
-
No products found
because this supplier's products are not listed.
D. Brent Halling, et al.,
bioRxiv - Biophysics 2022
Quote:
... Ca2+ chelators were used in the intracellular solution to control free Ca2+ and (+)-(Crown-6)-2,3,11,12-tetracarboxylic acid (Synquest Laboratories) was used to chelate any contaminating barium to prevent barium block of channels ...
-
No products found
because this supplier's products are not listed.
Fei Mao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... anti-GAPDH antibody (catalog # 2-RGM2, Advanced ImmunoChemical) was used at 1 μg/mL.
-
No products found
because this supplier's products are not listed.
Kevin N. Lin, Albert J. Keung, James M. Tuck,
bioRxiv - Synthetic Biology 2019
Quote:
Oligos were purchased with a 5’ biotin modification (Eton Bioscience). Toehold strands were diluted to 1011 strands and mixed with biotinylated oligos at a ratio of 1:40 in a 50 µL reaction containing 2 mM MgCl2 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Kelly M. Hennessey, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the C terminus of GL50803_8445 was tagged with an 11-amino acid flexible linker and the fluorescent protein mNeonGreen (Allele Biotechnology). The mNG-N11-Neo vector was constructed for this purpose by amplifying mNeonGreen using the primers listed in Table S1 ...
-
No products found
because this supplier's products are not listed.
Sangam Kandel, et al.,
bioRxiv - Genomics 2023
Quote:
... Samples were tested for the SARS-CoV-2 using the Aptima® SARS-CoV-2 (Panther® System, Hologic, San Diego, CA) nucleic acid amplification assay ...
-
No products found
because this supplier's products are not listed.
Jens O. Watzlawik, et al.,
bioRxiv - Neuroscience 2024
Quote:
... free p-S65-Ub peptides 1 and 2 and BSA-conjugated p-S65-Ub peptides 1 and 2 (provided by 21st Century Biochemicals). Non-phosphorylated Ub protein (Boston Biochem ...
-
No products found
because this supplier's products are not listed.
Stanislav Jabinski, et al.,
bioRxiv - Microbiology 2023
Quote:
Medium water samples (2 mL) or CO2 headspace (2 mL) gas were injected into a helium-flushed 12 mL exetainer vials (Exetainer, Labco Limited, UK). Water samples were acidified with 0.1 mL 85% H3PO4 and left to equilibrate for at least 24 hours before measurement ...
-
No products found
because this supplier's products are not listed.
Jingling Zhao, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and GHb was evaluated every 2 months (Helena Laboratories).
-
No products found
because this supplier's products are not listed.
Daniel Lyngholm, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 5-10nl of red or green fluorescent latex microspheres (Lumafluor, USA) (Katz et al. ...
-
No products found
because this supplier's products are not listed.
Andrew Chase, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Rabbit anti-FLAG (Signalway Antibody LLC, Maryland, USA; T503-2), tubulin (Abcam ...
-
No products found
because this supplier's products are not listed.
Saadia Hasan, et al.,
bioRxiv - Neuroscience 2023
Quote:
Human i3Neurons were maintained on PLO coated 12-well dishes in light amino acid-containing media (DMEM:F12 for SILAC medium (Athena Enzyme Systems #0423), N2 Supplement (Life Technologies Corporation #17502048) ...
-
No products found
because this supplier's products are not listed.
Qian Li, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5 mM MgCl2) was prepared on a Gradient Station platform (Biocomp Instruments). 450 µl of the lysate was carefully layered on top of the sucrose gradient and centrifuged at 35000 rpm (210000g ...
-
No products found
because this supplier's products are not listed.
Shuo Yang, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-SARS-CoV-2-ORF3a (1:250; 101AP, FabGennix International Inc), anti-Actin (1:500 ...
-
No products found
because this supplier's products are not listed.
Amanda J. Stock, et al.,
bioRxiv - Immunology 2024
Quote:
... and 2-mercaptoethanol) at 37°C in a Jitterbug Microplate Shaker (Boekel Scientific). After 30 minutes (min ...
-
No products found
because this supplier's products are not listed.
Qiang Li, et al.,
bioRxiv - Genomics 2021
Quote:
... were first treated with oxygen plasma for 5 mins (Anatech Barrel Plasma System, 100W, 40% O2) followed by methacryloxypropyltrimethoxysilane (Bind-Silane ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and chicken anti-microtubule associated protein 2 (MAP2, 1:500, EnCor Biotechnology Inc, FL, USA), followed by an incubation (3 days ...
-
No products found
because this supplier's products are not listed.
Athanasios Papadas, et al.,
bioRxiv - Immunology 2021
Quote:
Paraffin-embedded murine tumor sections and unstained 4-5 μm-thick human lung carcinoma TMA (US Biomax Inc., BC041115e) sections were deparaffinized and rehydrated using standard methods ...
-
No products found
because this supplier's products are not listed.
Bryana N. Harris, et al.,
bioRxiv - Systems Biology 2022
Quote:
Cardiac myocytes were isolated from 1-2-day-old Sprague-Dawley rats using a Neomyt isolation kit (Cellutron, USA). The cells were cultured in plating media (low-glucose Dulbecco’s modified eagle media (DMEM) ...
-
ELISA, ICC/IF
Cat# CDC-36,
0.1 mg, Inquire
Ask
Pragya D Yadav, et al.,
bioRxiv - Microbiology 2021
Quote:
... Pseudovirus (an HIV-based luciferase expressing lentivirus pseudotyped with SARS-CoV-2 full length S protein) was obtained from Creative Biogene. One step luciferase assay kit from BPS Bioscience was used for detection ...