-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Erik van Tilburg Bernardes, et al.,
bioRxiv - Microbiology 2019
Quote:
... trisodium salt (FSA, 478 daltons; Setareh Biotech, LLC, Eugene, OR, USA). Small intestinal transit was assessed as previously described in detail53 ...
-
No products found
because this supplier's products are not listed.
Gabriela Krejčová, et al.,
bioRxiv - Immunology 2021
Quote:
... 2 g/L sodium bicarbonate (J&K Scientific), 10% FBS (Biosera ...
-
No products found
because this supplier's products are not listed.
Sangnam Kim, Siyuan Zhang, Sangpil Yoon,
bioRxiv - Bioengineering 2021
Quote:
... add 2 ml of SoluLyse-Sodium Phosphate reagent (Genlantis) per 2 ml of pooled culture ...
-
No products found
because this supplier's products are not listed.
Valentina Ramponi, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Palbociclib (100mg/kg in 50mM sodium lactate) (Ambeed, #A295334), BEZ235 (35mg/kg in a solution of PEG400 and PHOSAL 50 PG 1:2 ...
-
No products found
because this supplier's products are not listed.
John H. Day, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Gel solution composed of 4.04M sodium acrylate (AK Scientific R624), 0.506M acrylamide (MilliporeSigma A4058) ...
-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 μl of 5× TuneUp solution (NanoHelix, Korea), 1 μl of Taq-plus polymerase (NanoHelix ...
-
No products found
because this supplier's products are not listed.
Lukas-Adrian Gurzeler, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... eluted with 1 mM sodium citrate pH 6.4 (Gene Link, Cat. No. 40-5014-05) and quantified as mentioned above.
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
... then coverslips were washed with Hanks Balanced Salt Solution (HBSS) and each placed in a 35-mm petri-dish containing Hibernate E low-fluorescence medium (HELF, BrainBits/Transnetyx), and cells were imaged immediately on a heated stage of 37°C with a 63/N.A.0.9 water-immersion objective ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Mark A. Skylar-Scott, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5 μM SB431542 (BioGems, #3014193), and 100 nM LDN193189 (BioGems ...
-
No products found
because this supplier's products are not listed.
Ayijiang Yisimayi, et al.,
bioRxiv - Immunology 2023
Quote:
... BA.5 (ACROBiosystems, SPN-C522e) were used for mouse immunization ...
-
No products found
because this supplier's products are not listed.
RAG da Silva, et al.,
bioRxiv - Microbiology 2019
Quote:
... ET-5 purchased from LGC Standards and L91543 serogroup C:2aP1.2 ...
-
No products found
because this supplier's products are not listed.
Masaharu Somiya, Shun’ichi Kuroda,
bioRxiv - Cell Biology 2021
Quote:
... Transporter 5 Transfection Reagent (Polyscience, Inc.), or branched 25-kDa polyethyleneimine (PEI ...
-
No products found
because this supplier's products are not listed.
Prashant P. Damke, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 5% FBS (Cell Biologics H6621) in collagen-coated cell culture flasks at 5% CO2 and 37°C ...
-
No products found
because this supplier's products are not listed.
Xiaohui Zhao, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 5-fluorotryptamine hydrochloride (AstaTech, Catalog #52030), 6-fluorotryptamine (AstaTech ...
-
No products found
because this supplier's products are not listed.
Iosifina P. Foskolou, et al.,
bioRxiv - Immunology 2022
Quote:
... Eu-Protein A (5 nM, Cisbio), Streptavidin-Alexa Fluor 647 (6.25 nM ...
-
No products found
because this supplier's products are not listed.
Amitabh Das, et al.,
bioRxiv - Genetics 2023
Quote:
... a 5-0 silk suture (Roboz) was tied around the maxillary left second molar and left in place for 5 days(34) ...
-
No products found
because this supplier's products are not listed.
Erika Ganda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5 mL of sterile water and 5 mL of 100% ethanol (Decon Labs, King of Prussia, PA) were added to the tube and the pellet was resuspended by vortexing ...
-
No products found
because this supplier's products are not listed.
Aleksandra A. Petelski, et al.,
bioRxiv - Bioengineering 2021
Quote:
... myFuge 5 (MTC Bio; cat. no: C2595).
-
No products found
because this supplier's products are not listed.
Yubao Fan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or 5% donkey serum (Abbkine, Wuhan, CN.) for 1 hour at room temperature ...
-
No products found
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and KAT 5 (KAT5-1350H; Creative Biomart) proteins following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Benjamin T. Throesch, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 mM MgCl2-6H2O (Honeywell Research Chemicals), 1 mM CaCl2 (Honeywell Research Chemicals) ...
-
No products found
because this supplier's products are not listed.
Kellen J. Cavagnero, et al.,
bioRxiv - Immunology 2020
Quote:
Mouse BAL and lung cells were suspended in a solution of 2% FBS and 0.01% sodium azide in PBS and counted on a Novocyte (Acea Biosciences). Cells were incubated with an unconjugated mAb to CD16/CD32 for 10 minutes at 4C to block non-specific Fc receptor binding and then incubated for 30 minutes with fluorochrome conjugated antibodies at 4C ...
-
No products found
because this supplier's products are not listed.
Charles Bayly-Jones, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 μL of diluted C9-depleted serum (Complement Tech; diluted 1 in 5 with 1×DGHB; 2.5% (w/v) D-glucose ...
-
No products found
because this supplier's products are not listed.
Shijian Zhang, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... resuspended in 1×PBS to a final concentration of 5 mg of wet membrane per ml of 1×PBS and crosslinked with 5 mM BS3 (Proteochem), followed by solubilization with a solubilization buffer containing 100 mM (NH4)2SO4 ...
-
Anti-convulsant
Sold for research purposes only.
Cat# 3127.0, SKU# 3127-100 mg,
100mg, US $55.00 / EA, EURO, €50 / EA
Ask
M. Joaquina Delás, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 5 µM CHIR99021 (Axon Medchem, Cat. No. 1386), 10 µM SB-431542 (Tocris ...
-
No products found
because this supplier's products are not listed.
Benjamin A Nanes, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5% bovine serum albumin (Equitech-Bio BAH65-0500), and 0.5% Triton X-100 (Sigma X100 ...
-
No products found
because this supplier's products are not listed.
Mohammad E. Afshar, et al.,
bioRxiv - Bioengineering 2019
Quote:
... 5 ng/mL basic fibroblast growth factor (bFGF; ImmunoTools) and 1% penicillin-streptomycin (Life Technologies) ...
-
No products found
because this supplier's products are not listed.
Emily B. Cohen, Renee C. Geck, Alex Toker,
bioRxiv - Cancer Biology 2020
Quote:
... containing 5% w/v nonfat dry milk (Andwin Scientific) for 1 hr and then incubated with primary antibody diluted in TBST with 5% bovine serum albumin (BSA ...
-
No products found
because this supplier's products are not listed.
Julia Fath, et al.,
bioRxiv - Cell Biology 2022
Quote:
... TAMRA(5-Carboxytetramethylrhodamine)-peptides were synthetized by ProteoGenix (France).
-
No products found
because this supplier's products are not listed.
D. Lapaillerie, et al.,
bioRxiv - Microbiology 2020
Quote:
... The 5’-biotinylated 601 sequence was purchased from TEBU-Bio. Biotinylated histone tail peptides were purchased from Eurogentech (Angers ...
-
No products found
because this supplier's products are not listed.
Mari Suzuki, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Clone C92F3-5 (StressMarq Biosciences Cat# SMC-100, 1:2000); anti-HSP90 ...
-
No products found
because this supplier's products are not listed.
Richard J. R. Kelwick, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... A549 EVs (100 μg; #HBM-A549-100/5, HansaBioMed, Tallinn, Estonia) were lysed and processed according to the manufacturer’s guidelines and the developed dot blot array was imaged using a ChemiDoc imaging system (Bio-Rad Laboratories Inc. ...
-
No products found
because this supplier's products are not listed.
Tyler C. Detomasi, et al.,
bioRxiv - Genetics 2022
Quote:
... and an ITC-5 temperature controller (Oxford Instruments, Abingdon, United Kingdom). Spectra were acquired under slow-passage non-saturating conditions.
-
No products found
because this supplier's products are not listed.
Raife Dilek Turan, et al.,
bioRxiv - Immunology 2021
Quote:
5 μg / ml of SARS-COV-2 Spike S1 Monoclonal Antibody (ElabScience) antibodies were added in the gel at a concentration of 2% ...
-
No products found
because this supplier's products are not listed.
Hsiao-Jou Cortina Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... filtered and incubated with 5 mL PureCube Ni-NTA agarose (Cube Biotech) for 1 h at 21°C ...
-
No products found
because this supplier's products are not listed.
Sumit J. Bandekar, et al.,
bioRxiv - Biochemistry 2024
Quote:
... ADGRL3 + GFP and TEN2 + dsRed and 5 μL LipoD293T (SL100668; SignaGen Laboratories). Two days after transfection ...
-
No products found
because this supplier's products are not listed.
Xiaoshan Shi, et al.,
bioRxiv - Biochemistry 2020
Quote:
100 nM purified ULK1 complex was mixed with 5 µM ULKtide (SignalChem Biotech Inc.), and incubated at room temperature for 1 h ...
-
No products found
because this supplier's products are not listed.
Jie Su, Naoko Toyofuku, Takuro Nakagawa,
bioRxiv - Genomics 2021
Quote:
... After adding 5 to 10 µl Zymolyase 20T (Seikagaku, Tokyo, Japan, 25 mg/ml) and 5 to 10 µl lyzing enzyme (Sigma ...
-
No products found
because this supplier's products are not listed.
DT Dinh, et al.,
bioRxiv - Molecular Biology 2021
Quote:
CBAF1 female mice were stimulated with 5 IU eCG (Lee BioSolutions, Maryland Heights, USA) and culled at 44 hours post-eCG ...
-
No products found
because this supplier's products are not listed.
Tábata Apablaza, et al.,
bioRxiv - Physiology 2024
Quote:
... Paraffin sections (5 μm) were treated with 1X EDTA buffer pH 8.0 (Diagnostic Biosystem), blocked with 2.5% normal goat serum (Vector Laboratories cat# S-1012) ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolome Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=5) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Lindsay Smith, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... zebrafish were incubated for 5 min at 28.5°C with optovin 6b8 (ID 5705191l; ChemBridge), an optovin analog (Kokel et al. ...
-
No products found
because this supplier's products are not listed.
Soma Dash, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... The C57BL/6J females were superovulated following standard procedures with 5 IU PMSG (Genway Biotech, #GWB-2AE30A) followed 46 hours later with 5 IU hCG (Sigma ...
-
Cat# LC10000,
10mg, USD $170.00/10mg
Ask
Perrine Verdys, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 0.5 μM β-estradiol (Sigma-Aldrich #E2758)] and transduced with 1:5 (vol:vol) Thy1.1-expressing ER-HoxB8 retrovirus supernatant using Lentiblast Premium (OZ Biosciences). After one or two weeks ...
-
No products found
because this supplier's products are not listed.
Geoffrey A. Smith, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were washed and then treated with 5 µg/ml 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI) labeled LDL (Kalen Biomedical) in low-glucose DMEM with 0.5% BSA (MilliporeSigma ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Bruno Raposo, et al.,
bioRxiv - Immunology 2022
Quote:
... transfer of 1.5 mg per mouse of a 5 monoclonal anti-type II collagen (CII) antibody cocktail (Chondrex, USA). 3 days later ...
-
No products found
because this supplier's products are not listed.
Callie P. Wigington, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5-6 mg of lysate was used for pull-downs with 30 μl of GFP-Trap magnetic beads (Bulldog Bio. Inc.) in binding buffer (50 mM Tris-HCl pH 7.5 ...