-
No products found
because this supplier's products are not listed.
Emma Bergsten, et al.,
bioRxiv - Microbiology 2023
Quote:
... folic acid 500 μg/L) or on Columbia agar solid support enriched with 5% horse blood (COH) (Biorad). Anoxic conditions were generated in Gaspack (BD ...
-
No products found
because this supplier's products are not listed.
Abigail K. Grosskopf, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A stock solution of alginate (5 wt%) and hyaluronic acid (HA) (Lifecore Biomedical, 1.5 MDA, 1.25 wt%) was also prepared in saline ...
-
No products found
because this supplier's products are not listed.
Juliane Tschuck, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and Obeticholic Acid (cholic acid derivative, FXR agonist, BioVision).
-
No products found
because this supplier's products are not listed.
Tommy Weiss-Sadan, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Peptides were desalted with stage tips using the following procedure: Peptides were reconstituted with 5% acetonitrile/0.1 % formic acid and loaded onto Empore C18 disks (3M) packed into a 200 µl pipette tips pre-equilibrated with LC-MS grade methanol and water containing 0.1% formic acid ...
-
No products found
because this supplier's products are not listed.
Hongwei Cai, et al.,
bioRxiv - Bioengineering 2022
Quote:
... the spheroids were then transferred to spinal cord medium II (ScM II) with 10 nM retinoic acid and 5 ng/mL recombinant human BMP4 (Peprotech) for the next 6 days ...
-
No products found
because this supplier's products are not listed.
Zachory M. Park, et al.,
bioRxiv - Genetics 2023
Quote:
... Cells were lysed using a FastPrep (MP) bead beater (5 x 90 second runs at 4°C) and acid-washed glass beads (BioSpec), centrifuged ...
-
No products found
because this supplier's products are not listed.
Yian Guan, et al.,
bioRxiv - Molecular Biology 2022
Quote:
L-ascorbic acid sodium (Solarbio) stock solution (2 M ...
-
No products found
because this supplier's products are not listed.
Gregor Diensthuber, et al.,
bioRxiv - Genomics 2023
Quote:
... using 5-Methyluridine-5’-Triphosphate (5-mUTP, Trilink, N-1024-1) instead of UTP ...
-
No products found
because this supplier's products are not listed.
Åsa Ehlén, et al.,
bioRxiv - Cell Biology 2019
Quote:
The Polo-like binding domain (PBD) of PLK1 (amino acid 326 to amino acid 603) was amplified from the pTK24 plasmid (Addgene) and cloned into a pT7-His6-SUMO expression vector using NEB Gibson assembly (Gibson Assembly Master Mix ...
-
No products found
because this supplier's products are not listed.
Dillon G. Patterson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5 ng/ml IL-5 (Biolegend; 581504), and 20 ng/ml IL-2 (Biolegend ...
-
No products found
because this supplier's products are not listed.
Prasath Paramasivam, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Timo Engelsdorf, et al.,
bioRxiv - Plant Biology 2019
Quote:
... extraction was performed in 10 % methanol / 1 % acetic acid with Jasmonic-d5 Acid and Salicylic-d4 Acid (CDN Isotopes) as internal standards ...
-
No products found
because this supplier's products are not listed.
Jie Zhou, et al.,
bioRxiv - Pathology 2020
Quote:
... Maslinic acid was purchased from APExBIO Technology LLC (Houston ...
-
5-Methoxysalicylic acid is a chemical compound belongs to the class of organic compounds known...
Cat# S6319, SKU# S6319-25mg,
25mg, $97.00
Ask
Cecilia Roux, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 2 uM retinoic acid (Selleck Chemicals), 0.66 uM JQ1 (Selleck Chemicals) ...
-
Glycosil® is a thiol-modified hyaluronic acid. Glycosil® hyaluronic acid is a component of the...
Cat# GS220F,
5 mL, USD $200.0
Ask
Haiyan Li, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Thiol-conjugated hyaluronic acid (Glycosil®; Advanced BioMatrix) was reconstituted in sterile diH2O containing 0.5% (w/v ...
-
No products found
because this supplier's products are not listed.
Hattie Chung, et al.,
bioRxiv - Genomics 2021
Quote:
... 5% normal donkey serum and 5% normal goat serum (Jackson Immunoresearch) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Jin Luo, et al.,
bioRxiv - Microbiology 2020
Quote:
... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
No products found
because this supplier's products are not listed.
Christian Franke, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 5 % CO2 (Eppendorf). Jurkat CD4-KO cells were derived from wild-type Jurkat T cells (clone E6 ...
-
No products found
because this supplier's products are not listed.
Xing Xiao, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 x 10-5 M DL-AP5 (DL-2-amino-5-phosphonopentanoic acid, BN0086, Biotrend), and 10-5 M CNQX (6-cyano-7-nitroquinoxaline-2,3-dione ...
-
No products found
because this supplier's products are not listed.
Amit Pathania, et al.,
bioRxiv - Microbiology 2020
Quote:
... Three fatty acids (C14:0; myristic acid, C16:0; palmitic acid and C18:1; oleic acid;, Larodan Fine Chemicals, Sweden) were prepared as 100 mM stocks in DMSO and used at final equimolar concentrations of 0.17 mM each in experiments (referred as eFA) ...
-
No products found
because this supplier's products are not listed.
Johan Zeelen, et al.,
bioRxiv - Microbiology 2020
Quote:
... For phasing the crystals were soaked overnight in 50 mM 5-amino-2,4,6-triiodoisophthalic acid (I3C)/LiOH (Magic Triangle, Jena Biosciences)42 in cryobuffer ...
-
No products found
because this supplier's products are not listed.
Philippe Vogeleer, et al.,
bioRxiv - Microbiology 2019
Quote:
... Overnight cultures at 37°C in LB media were diluted (1:100) in 5 ml of morpholine propanesulfonic acid (MOPS) minimal medium (Teknova) containing 0.2% (wt/vol ...
-
No products found
because this supplier's products are not listed.
Dionísio Pedro Amorim Neto, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The peptides were separated with a 2-30% acetonitrile gradient in 0.1% formic acid using a PicoFrit analytical column (20 cm x 75 nm, particle size from 5 μm, New Objective) at a flow rate of 300 nL/min over 173 min ...
-
No products found
because this supplier's products are not listed.
Subhrajit Banerjee, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 50 ml log phase yeast cultures of the indicated genotypes were gown for up to 5 doublings in SC medium at 18°C with 250µCi of [3H]-Palmitic acid (American Radiolabeled Chemicals, ART0129A). For pulse labeling with [3H]-Serine ...
-
No products found
because this supplier's products are not listed.
Chance J. Cosgriff, et al.,
bioRxiv - Microbiology 2019
Quote:
... supplemented with 1% casamino acids (Amresco) and 2.4 mM Sodium bicarbonate (Amresco) ...
-
No products found
because this supplier's products are not listed.
Silvia Ceschi, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 1% non-essential amino acids (Euroclone) and 1% penicillin/streptomycin (Euroclone) ...
-
No products found
because this supplier's products are not listed.
Valérie Wattelet-Boyer, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and 2.5□mM morpholinoethanesulfonic acid (Euromedex # EU0033) pH 5.8 with KOH ...
-
No products found
because this supplier's products are not listed.
Anaïs Cardon, et al.,
bioRxiv - Immunology 2024
Quote:
... MP1 and SARS-CoV-2 Prot_S (SPIKE) (peptides pools of 15 amino acids length with 11 amino acid overlap, Miltenyi Biotec) in 5% human serum RPMI medium in the presence of 1µg/ml anti-CD40 (HB14 ...
-
No products found
because this supplier's products are not listed.
Glenn A.O. Cremers, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and the unnatural amino acid p-BpA (Bachem) in a final concentration of 1 mM ...
-
No products found
because this supplier's products are not listed.
Amaris J Cardenas, et al.,
bioRxiv - Microbiology 2024
Quote:
... 0.06mM FAM alkyne 5-isomer (5-Carboxyfluorescein) (Lumiprobe), 2.4 mM L-ascorbic acid (VWR) ...
-
No products found
because this supplier's products are not listed.
Victoria Flores, et al.,
bioRxiv - Physiology 2022
Quote:
All amino acid defined diets were obtained from Envigo, and diet compositions and item numbers are provided in Tables 1 and 2 ...
-
A partially purified powder. Suitable as a substrate for hyaluronidase assays.
Cat# LS003911,
Bulk, Inquire
Ask
Hazel Tye, et al.,
bioRxiv - Immunology 2023
Quote:
... 1% (w/v) fatty acid-free BSA (Worthington, USA) was prepared by dissolving fatty acid-free BSA in serum-free DMEM containing 4 μM L-glutamine ...
-
No products found
because this supplier's products are not listed.
Evan M. Hess, et al.,
bioRxiv - Neuroscience 2022
Quote:
... supplemented with 5% fetal bovine serum/5% horse serum (Atlanta Biologicals), Glutamax (Gibco) ...
-
No products found
because this supplier's products are not listed.
Diego Cantoni, et al.,
bioRxiv - Microbiology 2020
Quote:
A 16 amino acids peptide (nh2-CMHRDYNHDMSDKHRA −conh2) was designed by Eurogentec based on the provide sequence of AOX of Naegleria gruberi (XP_002672918 ...
-
No products found
because this supplier's products are not listed.
Ying Li, et al.,
bioRxiv - Cell Biology 2020
Quote:
... BODIPY-dodecanoic acid fluorescent fatty acid analog was added (QBT™ Fatty Acid Uptake Assay Kit, Molecular Devices) and the plate was immediately transferred to a fluorescence microplate reader for kinetic reading (every 20 seconds for 30-60 minutes ...
-
No products found
because this supplier's products are not listed.
Grace Ying Shyen Goh, et al.,
bioRxiv - Genetics 2022
Quote:
... and PUFAs (mix of fatty acid sodium salts: 150 μM C18:2, S-1127; 150 μM C20:5, S-1144, Nu-Chek Prep). E ...
-
No products found
because this supplier's products are not listed.
Holly Melland, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), DL- 2-Amino-5-phosphonopentanoic acid (AP5), and Bafilomycin A1 were distributed by Sapphire Bioscience (Sydney, Australia) from Enzo Life Sciences (Lausen, Switzerland), Cayman Chemical (Ann Arbor ...
-
No products found
because this supplier's products are not listed.
Antwi-Boasiako Oteng, et al.,
bioRxiv - Physiology 2021
Quote:
... non-esterified fatty acids (Wako Diagnostics), and cholesterol (Cholesterol E ...
-
No products found
because this supplier's products are not listed.
Manuele Rebsamen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Starvation media lacking a specific amino acid were prepared by complementing amino acid-free DMEM media (ie devoid of all 15 amino acids normally present, custom made by PAN biotech) with the other 14 amino acids (from individual powders ...
-
No products found
because this supplier's products are not listed.
Jonathan Stoeber, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The UV-Visible spectrum of each sample was recorded for both tannic acid and gallic acid for both pH’s using a DU730 UV-Visible Spectrometer (Beckman Coulter, Pasadena, CA). The spectra were recorded from 250-400 nm with 0.2 nm data intervals ...
-
No products found
because this supplier's products are not listed.
Marcus A Begley, et al.,
bioRxiv - Cell Biology 2020
Quote:
... supplemented with non-essential amino acids (Genesee 25-536), sodium pyruvate (Genesee 25-537) ...
-
No products found
because this supplier's products are not listed.
Hannah Laeverenz Schlogelhofer, et al.,
bioRxiv - Microbiology 2019
Quote:
... with nucleic acid staining and confocal microscopy (Olympus Fluoview FV1200) used to confirm an even distribution of cells on the filter ...
-
No products found
because this supplier's products are not listed.
Trisha A. Macrae, Miguel Ramalho-Santos,
bioRxiv - Molecular Biology 2020
Quote:
... 5 min total (Diagenode).
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Riss M. Kell, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Biomass was collected after 24hr by vacuum filtering each incubation sample at 34.5 kPa (5 psi) onto an acid-cleaned 3μm pore-size acrylic copolymer Versapore filter (Pall) mounted on an acid-cleaned plastic filtration rig ...
-
No products found
because this supplier's products are not listed.
Jack A. Bibby, et al.,
bioRxiv - Immunology 2022
Quote:
... Arachidonic acid measurement was done using the human arachidonic acid ELISA kit (Novus biologicals) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sally Adams, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... (25S)-Δ7-Dafachronic Acid (Cambridge Bioscience Ltd) was prepared as a 1 mM stock in 100 % ethanol ...
-
No products found
because this supplier's products are not listed.
Elizabeth T. Wiles, et al.,
bioRxiv - Molecular Biology 2019
Quote:
H3K27me3 (amino acids 23–34) peptide was obtained from Anaspec. For NMR studies ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Tarun Kumar, Leo Blondel, Cassandra G. Extavour,
bioRxiv - Developmental Biology 2020
Quote:
... 5 forceps (Fine Science Tools) and counted by counting the number of germaria under a ZEISS Stemi 305 compact stereo microscope with a NIGHTSEA stereo microscope UV Fluorescence adaptor.