-
No products found
because this supplier's products are not listed.
Sandra Schwarz, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... respective wells were treated with 400µM PI-9i (1,3-Benzoxazole-6-carboxylic acid, Advanced ChemBlocks Inc, Hayward, CA, USA). Following pre-treatment ...
-
No products found
because this supplier's products are not listed.
Matthew T. Parker, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and the 5′ cap was removed by Cap-Clip Acid Pyrophosphatase (Cambio) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled anti-MART-1 (ELAGIGILTV) dextramers (Immudex, 1:5), APC-labelled A*0201 dextramer negative control (Immudex ...
-
No products found
because this supplier's products are not listed.
Edward B. Irvine, et al.,
bioRxiv - Immunology 2023
Quote:
... or IgM (Life Diagnostics, clone 2C11-1-5) antibody was added at a concentration of 0.65μg/mL and incubated shaking at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Mari Suzuki, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Clone C92F3-5 (StressMarq Biosciences Cat# SMC-100, 1:2000); anti-HSP90 ...
-
No products found
because this supplier's products are not listed.
S. Hong Chan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 5’ Gppp- cap and 5’ m7Gppp- cap are synthesized by Bio-synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 1 µg of DNA were transfected using 5 µl Geneporter2 (Genlantis) or 1.5 µl Lipofectamine 2000 (Thermo Fisher).
-
No products found
because this supplier's products are not listed.
Changuk Chung, et al.,
bioRxiv - Neuroscience 2023
Quote:
... pellets were resuspended in 5 ml NF1 buffer and Dounce homogenized 5x in a 7 ml Wheaton Dounce Tissue Grinder (DWK Life Sciences) using a ‘loose’ pestle ...
-
No products found
because this supplier's products are not listed.
Koushik Debnath, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by negative staining with 8 μL of 6% uranyl acetate (SPI Supplies) in Milli-Q water for 20 s at RT in dark ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Tina Pekec, et al.,
bioRxiv - Physiology 2021
Quote:
... then 5 μM FeRhoNox™-1 solution (Goryo Chemical, Inc., Sapporo, Japan) was added and incubated in the dark at 37 °C for 1 h ...
-
No products found
because this supplier's products are not listed.
Allison R. Fusilier, et al.,
bioRxiv - Neuroscience 2021
Quote:
... BMAL1 (1:1000 in 5% BSA and TBST, Signalway Antibody, LLC, #21415,), GSK3β (3D10 ...
-
No products found
because this supplier's products are not listed.
Trevor S. Wendt, Rayna J. Gonzales,
bioRxiv - Physiology 2023
Quote:
... Endothelium-intact or -denuded rings were mounted on tungsten wires and immersed in PSS at 37°C with constant gassing (21% O2 and 5% CO2) in a wire myography chamber (DMT 610) and incubated ex vivo with oxLDL (50μg/dL; 2h; Kalen Biomedical, cat. no. 770202-7), followed by normalization and KCL (100mM ...
-
No products found
because this supplier's products are not listed.
Mohammed Mohasin, et al.,
bioRxiv - Immunology 2021
Quote:
... Nuclei were stained with 5 µM Draq5 (Biostatus Ltd. 1:1000 in PBS). Coverslips were mounted onto microscope slides with a glycerol free poly-(vinyl alcohol ...
-
No products found
because this supplier's products are not listed.
T.B. Wissing, et al.,
bioRxiv - Bioengineering 2021
Quote:
Rectangular Velcro strips of 5×15 mm each were attached to the flexible membranes of 6-well Bioflex culture plates (untreated, Flexcell Int, McKeesport, PA) (dynamic loading groups ...
-
No products found
because this supplier's products are not listed.
Alexander C. Whitebirch, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Diazepam (5 mg/kg, i.p.; McKesson #636203) was administered 1 hr after SE onset to curtail seizures ...
-
No products found
because this supplier's products are not listed.
Lukas Spiller, et al.,
bioRxiv - Immunology 2023
Quote:
... 5 nmol CpG (TIB MOLBIOL, Berlin, Germany), and an equal volume of Incomplete Freund’s adjuvant (IFA ...
-
No products found
because this supplier's products are not listed.
Md Imtiaz Khalil, Arrigo De Benedetti,
bioRxiv - Cancer Biology 2022
Quote:
LNCaP and PC3 cells were treated with 1-5 μM of GLPG 0259 (Medkoo Biosciences, Inc. ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Maria L. Sorkin, et al.,
bioRxiv - Plant Biology 2022
Quote:
... and 5 μM MG132 (Peptides International, Louisville, KY)) and sonicated using a duty cycle of 20 s (2 s on ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
Cat# 56461-21-3,
Inquire
Ask
Harikiran Nistala, et al.,
bioRxiv - Genetics 2020
Quote:
... and sodium tetraphosphate (P4, BOC Sciences 7727-67-5) was determined by a fixed time assay using BIOMOL GREEN phosphate detection kit (BML-AK111 ...
-
No products found
because this supplier's products are not listed.
Chun Hu, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Protein expression was induced by baculovirus infection of 6-8 liter cultures of Sf9 cells in ESF921 medium (Expression Systems) at a density of ~2 × 106 cells/ml ...
-
No products found
because this supplier's products are not listed.
Hadjara Sidibé, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A surgical sterile sponge soaked in 5% fluorogold (Fluorochrome, LLC) in sterile saline was deposit at the site of the nerve cut to enable visualization of injured motor neurons post-injury ...
-
No products found
because this supplier's products are not listed.
Maria Kuzikov, et al.,
bioRxiv - Molecular Biology 2023
Quote:
5 µl/ 100 nM of USP7/USP14 (BPS bioscience, #80364) were added to assay plates containing the compounds ...
-
No products found
because this supplier's products are not listed.
Apirat Chaikuad, et al.,
bioRxiv - Biochemistry 2019
Quote:
... the 5 uL reaction was performed with 4 ug/mL recombinant human ULK2 protein (1-478, SignalChem #U02-11G) and 80 ug/mL MBP in the presence of 25 uM ATP ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Andrew R Harris, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 5% biotinyl-amino-PEG (Rapp Polymere, #13 3000-25-20) which was incubated for a minimum of 4 hours at 50°C ...
-
No products found
because this supplier's products are not listed.
Ranmal A. Samarasinghe, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Papain was resuspended in 5 ml Hibernate E medium (Brainbits, #HE) containing N2 and B27 supplements (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Valérie Clavet-Fournier, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The ACSF solution was continuously infused with 5 % CO2 and delivered with a flow of ∼1 ml/min (MINIPULS 3 Peristaltic Pump, Gilson).
-
No products found
because this supplier's products are not listed.
Hsiao-Jou Cortina Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... filtered and incubated with 5 mL PureCube Ni-NTA agarose (Cube Biotech) for 1 h at 21°C ...
-
No products found
because this supplier's products are not listed.
Hanna G. Budayeva, et al.,
bioRxiv - Biochemistry 2023
Quote:
... peptides were cleaned up using a 5 µl C18 Phytip (Biotage, Inc) and injected for LC-MS/MS acquisition.
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Serial cross sections (5□µm thick) were immunostained with rabbit anti-mouse LYVE1 (1:100) polyclonal antibody (11-034, AngioBio Co). DAB (3,3′ -Diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Tsuyoshi Waku, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... After the treatment with 5 nM or 10 nM bortezomib (BTZ, Peptide Institute), the cells were stained by Trypan Blue and automatically counted using a TC20 Automated Cell Counter (Bio-Rad Laboratories).
-
No products found
because this supplier's products are not listed.
Alasdair TM Hubbard, et al.,
bioRxiv - Microbiology 2019
Quote:
... at 5 × 105 cells per ml in CnT-Prime medium (CnT-PR, CELLnTEC, Switzerland). An appropriate amount of CnT-PR was added to the basolateral chamber of the inserts so that the medium levels were equal ...
-
No products found
because this supplier's products are not listed.
Tim Nierhaus, et al.,
bioRxiv - Microbiology 2021
Quote:
... drops were pipetted up and down 5 times by the Mosquito robot (TTP Labtech) to minimise diffusion effects ...
-
No products found
because this supplier's products are not listed.
DT Dinh, et al.,
bioRxiv - Molecular Biology 2021
Quote:
CBAF1 female mice were stimulated with 5 IU eCG (Lee BioSolutions, Maryland Heights, USA) and culled at 44 hours post-eCG ...
-
No products found
because this supplier's products are not listed.
Thibault Courtellemont, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 0.5 OD600 units were transferred into 5 mL of SC-arginine/-lysine (Sunrise Science Products) supplemented with 0.43 mM arginine and lysine ...
-
No products found
because this supplier's products are not listed.
Terje Wimberger, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Adaptors to the flow system (NanoPort Std 6-32 Coned 1/32, IDEX, USA) were fixed to in- and outlets ...
-
No products found
because this supplier's products are not listed.
Amber M. Johnson, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... After blocking with 10% goat serum in equal parts of 5% BSA in TBST and Superblock (ScyTek Laboratories, AAA999) at 4°C overnight ...
-
No products found
Siiri I Salomaa, et al.,
bioRxiv - Cell Biology 2020
Quote:
... blocked with and stained in 5 % milk in TBST and detected using WesternBright ECL Western Blotting detection kit (#K-12045-D20, Advansta). For Coomassie Blue staining ...
-
No products found
because this supplier's products are not listed.
Lale Ozcan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Plasma insulin levels were measured in mice that were fasted for 5 h using an ultra-sensitive mouse insulin ELISA kit (Crystal Chem). The Columbia University IACUC provided ethical approval for these studies ...
-
No products found
because this supplier's products are not listed.
Keli Lima, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... resuspended in 100 μL PBS containing 5 μL of PE-labeled anti-CD11b (clone MEM-174, EXBIO Praha, Vestec, Czech Republic) or 5 μL of APC-labeled anti-CD14 (clone TÜK4) ...
-
No products found
because this supplier's products are not listed.
Aline Sardinha-Silva, et al.,
bioRxiv - Immunology 2024
Quote:
... and/or with 10 μg of both combined recombinant mouse IL-4-Fc and IL-13-Fc (5 μg of each) (Absolute Antibody) every other day for 10 days (5 treatments) ...
-
No products found
because this supplier's products are not listed.
Thadeu Estevam Moreira Maramaldo Costa, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Polycarbonate membrane filters with 8 µm pore size (Neuro Probe) were placed between the lower and upper chambers ...
-
Cat# F101,
USD $80.00/EA
Ask
Suzanne M Johnson, et al.,
bioRxiv - Cell Biology 2020
Quote:
... was centrifuged in 2 tubes to remove cells (300 × g 5 minutes, × 2) and filtered using a double layered 5µm pore nylon Sieve (Fisher Scientific: BioDesign cat 12994257). The supernatant was collected and centrifuged at 2000 × g for 30 minutes and prepared for ISX analysis ...
-
No products found
because this supplier's products are not listed.
Dávid Kovács, et al.,
bioRxiv - Cell Biology 2021
Quote:
... completed with 5% foetal bovine serum and 1% ZellShield (Minerva Biolabs). A549 cells were maintained in Dulbecco’s Modified Eeagle’s Medium (DMEM ...