-
No products found
because this supplier's products are not listed.
Prashant P. Damke, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 5% FBS (Cell Biologics H6621) in collagen-coated cell culture flasks at 5% CO2 and 37°C ...
-
No products found
because this supplier's products are not listed.
Amitabh Das, et al.,
bioRxiv - Genetics 2023
Quote:
... a 5-0 silk suture (Roboz) was tied around the maxillary left second molar and left in place for 5 days(34) ...
-
No products found
because this supplier's products are not listed.
Benjamin A Nanes, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5% bovine serum albumin (Equitech-Bio BAH65-0500), and 0.5% Triton X-100 (Sigma X100 ...
-
No products found
because this supplier's products are not listed.
Tyler C. Detomasi, et al.,
bioRxiv - Genetics 2022
Quote:
... and an ITC-5 temperature controller (Oxford Instruments, Abingdon, United Kingdom). Spectra were acquired under slow-passage non-saturating conditions.
-
No products found
because this supplier's products are not listed.
Sumit J. Bandekar, et al.,
bioRxiv - Biochemistry 2024
Quote:
... ADGRL3 + GFP and TEN2 + dsRed and 5 μL LipoD293T (SL100668; SignaGen Laboratories). Two days after transfection ...
-
No products found
because this supplier's products are not listed.
DT Dinh, et al.,
bioRxiv - Molecular Biology 2021
Quote:
CBAF1 female mice were stimulated with 5 IU eCG (Lee BioSolutions, Maryland Heights, USA) and culled at 44 hours post-eCG ...
-
No products found
because this supplier's products are not listed.
Xuwen Cao, et al.,
bioRxiv - Genetics 2021
Quote:
... C20:5 n3 (Larodan) and C18:0 ...
-
No products found
because this supplier's products are not listed.
Amarylis C.B.A. Wanschel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... NKX2-5 (orb-103103, Biorbyt).
-
No products found
because this supplier's products are not listed.
Sangsoon Park, et al.,
bioRxiv - Cell Biology 2023
Quote:
... or 5 µM CHIR99021 (A133052, Ambeed) for 48 hours under serum-free conditions to stimulate cardiomyocyte hypertrophy or proliferation ...
-
No products found
because this supplier's products are not listed.
Alexander C. Whitebirch, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Diazepam (5 mg/kg, i.p.; McKesson #636203) was administered 1 hr after SE onset to curtail seizures ...
-
No products found
because this supplier's products are not listed.
A. Florentin, et al.,
bioRxiv - Microbiology 2019
Quote:
... beads using 5 mM BS3 crosslinker (CovaChem) and then incubated with the supernatant at 4°C ...
-
No products found
because this supplier's products are not listed.
Kellie A. Cotter, et al.,
bioRxiv - Genomics 2022
Quote:
... to reduce uncapped RNAs to 5′ hydroxyls and make them incapable of ligating to 5′ adaptor and Cap-Clip (catalog no. C-CC15011H; Cambio) to remove the 5′ cap of transcripts that had undergone guanylation and allow them to be incorporated into the library through 5′ adapter ligation ...
-
No products found
because this supplier's products are not listed.
Shuai Qi, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 5 ul 2×Taq PCR mix (TIANGEN, China), 0.5 ul each primer (trnL and trnF (Taberlet et al. ...
-
No products found
because this supplier's products are not listed.
Dillon K. Jarrell, et al.,
bioRxiv - Bioengineering 2020
Quote:
P3-5 GFP-HUVECs (Angio-Proteomie cAP-0001GFP) and P3-5 human dermal fibroblasts (HDFs ...
-
No products found
because this supplier's products are not listed.
Edward B. Irvine, et al.,
bioRxiv - Immunology 2023
Quote:
... or IgM (Life Diagnostics, clone 2C11-1-5) antibody was added at a concentration of 0.65μg/mL and incubated shaking at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Emily B. Cohen, Renee C. Geck, Alex Toker,
bioRxiv - Cancer Biology 2020
Quote:
... containing 5% w/v nonfat dry milk (Andwin Scientific) for 1 hr and then incubated with primary antibody diluted in TBST with 5% bovine serum albumin (BSA ...
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
No products found
because this supplier's products are not listed.
Robert G. Stewart, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 5 mm German glass coverslips (Bellco Glass, 1943-00005), which had previously been washed in 70% ethanol and sterilized with ultraviolet light ...
-
No products found
because this supplier's products are not listed.
Hadjara Sidibé, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A surgical sterile sponge soaked in 5% fluorogold (Fluorochrome, LLC) in sterile saline was deposit at the site of the nerve cut to enable visualization of injured motor neurons post-injury ...
-
No products found
because this supplier's products are not listed.
Chloe R. Koulouris, et al.,
bioRxiv - Biophysics 2021
Quote:
... 5% ethylene glycol and 20% PEG Smear Broad (Molecular Dimensions). This crystallisation condition differs from that reported in a recent crystal structure of holo SR (6SLH ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled A*0201 dextramer negative control (Immudex, 1:5). Antibodies for western blot ...
-
No products found
because this supplier's products are not listed.
Mari Suzuki, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Clone C92F3-5 (StressMarq Biosciences Cat# SMC-100, 1:2000); anti-HSP90 ...
-
No products found
because this supplier's products are not listed.
Petr Šulc, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 5 µg of anti-dsRNA mAb (J2) (SCICONS, cat# 10010500) were bound to 30 µl of washed beads overnight at 4° C on a rotating wheel ...
-
No products found
because this supplier's products are not listed.
Kelli K. Mullane, et al.,
bioRxiv - Microbiology 2022
Quote:
... in which a 5 mL glass serum vial (DWK Life Sciences, New Jersey ...
-
No products found
because this supplier's products are not listed.
Hsiao-Jou Cortina Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... filtered and incubated with 5 mL PureCube Ni-NTA agarose (Cube Biotech) for 1 h at 21°C ...
-
No products found
because this supplier's products are not listed.
Qian Li, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5 mM MgCl2) was prepared on a Gradient Station platform (Biocomp Instruments). 450 µl of the lysate was carefully layered on top of the sucrose gradient and centrifuged at 35000 rpm (210000g ...
-
No products found
because this supplier's products are not listed.
Mingrui Guo, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... by submandibular venipuncture with 5-mm Goldenrod animal lancets (Braintree Scientific, cat.no. GR5MM). Counts of nucleated cells was performed using a NIHOKODEN auto blood cell counter under Pre-dilute 20 µl mode ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Geoffrey L. Rogers, et al.,
bioRxiv - Immunology 2023
Quote:
... Plates were coated with either 5 µg/mL JR-CSF gp120 (Immune Technology) in coating buffer for samples ...
-
No products found
because this supplier's products are not listed.
Longhuan Ma, et al.,
bioRxiv - Immunology 2024
Quote:
... then individual colonies were grown in 5 ml of BHI media (Anaerobe Systems) under anaerobic conditions for 16 h ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Resin was treated with 25mU of Arthrobacter ureafaciens sialidase (EY laboratory, EC-32118-5) at room temperature for 1 hr and then washed with 10 ml of 10 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Jie Su, Naoko Toyofuku, Takuro Nakagawa,
bioRxiv - Genomics 2021
Quote:
... After adding 5 to 10 µl Zymolyase 20T (Seikagaku, Tokyo, Japan, 25 mg/ml) and 5 to 10 µl lyzing enzyme (Sigma ...
-
No products found
because this supplier's products are not listed.
Tábata Apablaza, et al.,
bioRxiv - Physiology 2024
Quote:
... Paraffin sections (5 μm) were treated with 1X EDTA buffer pH 8.0 (Diagnostic Biosystem), blocked with 2.5% normal goat serum (Vector Laboratories cat# S-1012) ...
-
No products found
because this supplier's products are not listed.
Ekaterina Kropocheva, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5% glycerol) supplemented with 1 mM of PMSF and disrupted using Cell Disruptor CF (Constant Systems). The lysate was cleared by centrifugation ...
-
No products found
because this supplier's products are not listed.
Qiang Li, et al.,
bioRxiv - Genomics 2021
Quote:
... were first treated with oxygen plasma for 5 mins (Anatech Barrel Plasma System, 100W, 40% O2) followed by methacryloxypropyltrimethoxysilane (Bind-Silane ...
-
No products found
because this supplier's products are not listed.
Irene P. Ayuso-Jimeno, et al.,
bioRxiv - Neuroscience 2021
Quote:
Mice were anesthetized with 5% isoflurane and subsequently head fixed in a stereotaxic frame (RWD Life Science) with body temperature maintained at 37 °C ...
-
No products found
because this supplier's products are not listed.
Abigail K. Grosskopf, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A stock solution of alginate (5 wt%) and hyaluronic acid (HA) (Lifecore Biomedical, 1.5 MDA, 1.25 wt%) was also prepared in saline ...
-
No products found
because this supplier's products are not listed.
Soma Dash, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... The C57BL/6J females were superovulated following standard procedures with 5 IU PMSG (Genway Biotech, #GWB-2AE30A) followed 46 hours later with 5 IU hCG (Sigma ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 1 mg/mL 5-fluoroorotic acid monohydrate (5-FOA) (Matrix Scientific, CAS[220141-70-8]) in S/MSG D media (1.71 g/L Yeast Nitrogen Base Without Amino Acids and Ammonium Sulphate ...
-
No products found
because this supplier's products are not listed.
Shinya Ohara, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Biocytin (5 mg/mL; Iris Biotech) was added to the internal solution in order to recover cell morphology ...
-
No products found
because this supplier's products are not listed.
Rebecca Fu, et al.,
bioRxiv - Microbiology 2023
Quote:
... and goat α-Rab 5 (antibodies-online) 1:1000 ...
-
No products found
because this supplier's products are not listed.
Ana J. Chucair-Elliott, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and positive fraction) and mouse methylation controls (#80-8063-MGHM-5 and #80-8064-MGUM-5; EpigenDX, Hopkinton, MA) were diluted in nuclease free elution buffer (Qiagen ...
-
No products found
because this supplier's products are not listed.
Zelin Liu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... second-strand cDNAs were synthesized using P2-T24 (5’-ATATCTCGAGGGCGCGCCGGATCCTTTTTTTTTTTTTTTTTTTTTTTT-3’) by I-5 High-Fidelity DNA polymerase (MCLAB) at 98°C for 2 min ...
-
Cat# 27402-68-2,
Inquire
Ask
Harikiran Nistala, et al.,
bioRxiv - Genetics 2020
Quote:
... and sodium tetraphosphate (P4, BOC Sciences 7727-67-5) was determined by a fixed time assay using BIOMOL GREEN phosphate detection kit (BML-AK111 ...
-
No products found
because this supplier's products are not listed.
Richard J. R. Kelwick, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... A549 EVs (100 μg; #HBM-A549-100/5, HansaBioMed, Tallinn, Estonia) were lysed and processed according to the manufacturer’s guidelines and the developed dot blot array was imaged using a ChemiDoc imaging system (Bio-Rad Laboratories Inc. ...
-
No products found
because this supplier's products are not listed.
Raife Dilek Turan, et al.,
bioRxiv - Immunology 2021
Quote:
5 μg / ml of SARS-COV-2 Spike S1 Monoclonal Antibody (ElabScience) antibodies were added in the gel at a concentration of 2% ...
-
No products found
because this supplier's products are not listed.
Xiaoshan Shi, et al.,
bioRxiv - Biochemistry 2020
Quote:
100 nM purified ULK1 complex was mixed with 5 µM ULKtide (SignalChem Biotech Inc.), and incubated at room temperature for 1 h ...
-
All viral vectors
Cat# KM30500,
ViroMag 100µL + ViroMag RL 100µL + AdenoMag 100µL, USD $235.75/KIT
Ask
Perrine Verdys, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 0.5 μM β-estradiol (Sigma-Aldrich #E2758)] and transduced with 1:5 (vol:vol) Thy1.1-expressing ER-HoxB8 retrovirus supernatant using Lentiblast Premium (OZ Biosciences). After one or two weeks ...