-
No products found
because this supplier's products are not listed.
Karl Alex Hedin, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... for preventing bacterial growth and 1 g/L 5-Fluoroorotic Acid (5-FOA; Nordic BioSite) for preventing other yeast species from growing.
-
No products found
because this supplier's products are not listed.
Paul D. Simonson, Itzel Valencia, Sanjay S. Patel,
bioRxiv - Immunology 2022
Quote:
... we created the following custom-conjugated oligomer (5’ to 3’, custom orders to Gene Link, Elmsford, New York):
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 1 mg/mL 5-fluoroorotic acid monohydrate (5-FOA) (Matrix Scientific, CAS[220141-70-8]) in S/MSG D media (1.71 g/L Yeast Nitrogen Base Without Amino Acids and Ammonium Sulphate ...
-
No products found
because this supplier's products are not listed.
Jessica Hoff, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and 5 U mL-1 DY-636 conjugated Phalloidin (Dyomics) for 60 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Rebekah Honce, et al.,
bioRxiv - Microbiology 2021
Quote:
... and oseltamivir carboxylate (Toronto Research Chemicals, Lot 3-SKC-52-1, Purity 98%) with a qualified LC MS/MS assay ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Anna E. Boczula, et al.,
bioRxiv - Microbiology 2021
Quote:
... all cells were centrifuged at 220 xg RT for 5 min followed by resuspension with fresh complete media and plated at 1:5 (Cell Systems cells)-1:10 (Lonza cells ...
-
No products found
because this supplier's products are not listed.
Marissa L. Maciej-Hulme, et al.,
bioRxiv - Biochemistry 2020
Quote:
1 µl BODIPY-FL hydrazide (5 mg/mL, Setareh Biotech, Eugene, OR, USA) in DMSO was diluted in HPLC grade water before addition of organic solvent in a 1:9 (v/v ...
-
No products found
because this supplier's products are not listed.
Michael G. LaMontagne, et al.,
bioRxiv - Microbiology 2022
Quote:
... Temperature and dissolved oxygen were measured in situ at 3 – 5 cm beneath the surface with a YSI model 55 dissolved oxygen (DO) probe (YSI Inc., Young Spring, OH). Water samples were split in the field for FIB (E ...
-
ELISA, ICC/IF
Cat# CDC-36,
0.1 mg, Inquire
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Frank M. Mason, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... telomere (PNA, TelC-A647, 1:500), Acro-P (Cytocell, LPE NOR, undiluted) or rDNA (Empire Genomics, RPCI23-225M6, 1:5) FISH probes were diluted in hybridization solution (10mM Tris-HCl pH7.2 ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2021
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-3 and # 101-5) in RPMI 1640 1% FBS ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Yen-Chun Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (3Helix; R-CHP; 5 μM).
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Kathleen N. Brown, et al.,
bioRxiv - Pathology 2023
Quote:
... and the cells were resuspended in ~500 μL 1% FBS in PBS and transferred to polystyrene 5 ml flow cytometry tubes (MTC Bio). The samples were placed on ice and protected from light until flow cytometry could be performed ...
-
No products found
because this supplier's products are not listed.
Li-Ying Yu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The cells were grown for 5 days in iCell Neural Base Medium 1+ iCell Neural Supplement B (M1010, M1029, FUJIFILM Cellular Dynamics). Then the cells were treated with 6-OHDA (50 µM ...
-
No products found
because this supplier's products are not listed.
Brandon T. Cisneros, Neal K. Devaraj,
bioRxiv - Synthetic Biology 2020
Quote:
... 3-Methylxanthine was purchased from AK Scientific (Union City, CA). Xanthine was purchased from Chem Impex International (Wood Dale ...
-
No products found
because this supplier's products are not listed.
Manish Bodas, et al.,
bioRxiv - Cell Biology 2021
Quote:
Immunofluorescent staining of either differentiating cells in ALI wells or of the paraffin embedded human bronchus from healthy nonsmokers (Donor 1: Age 27, Female; Donor 2: Age 40, Female and Donor 3: Age 27, Female; catalog number HuFPT111, US Biomax, Inc., Rockville, MD, USA), or mouse trachea (C57BL/6 ...
-
No products found
because this supplier's products are not listed.
A. Florentin, et al.,
bioRxiv - Microbiology 2019
Quote:
... beads using 5 mM BS3 crosslinker (CovaChem) and then incubated with the supernatant at 4°C ...
-
No products found
because this supplier's products are not listed.
Benjamin T. Throesch, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 mM MgCl2-6H2O (Honeywell Research Chemicals), 1 mM CaCl2 (Honeywell Research Chemicals) ...
-
No products found
because this supplier's products are not listed.
Eric Waltari, et al.,
bioRxiv - Immunology 2019
Quote:
We printed our arrays with the PDC70 type 3 nozzle (Scienion) due to its reduced dispense volume and the specific hydrophobic coating optimized to improve the dispense stability of protein solutions ...
-
No products found
because this supplier's products are not listed.
Xingyue An, et al.,
bioRxiv - Immunology 2020
Quote:
... 2′-3’′cyclic guanosine monophosphate adenosine monophosphate (cGAMP) from Chemietek (Indianapolis, IN). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) ...
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... the Fe with 1wt% VH precursor mixture was loaded into a custom-build consolidation die and high-pressure cold-sintered at 2.5 GPa (corresponding to 5 t for 5 mm diameter die) and RT using manual press (Carver, Wabash, IN, USA) to obtain the drug-loaded metal (Supplementary Materials ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Robert G. Stewart, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 5 mm German glass coverslips (Bellco Glass, 1943-00005), which had previously been washed in 70% ethanol and sterilized with ultraviolet light ...
-
No products found
because this supplier's products are not listed.
Aritra Nath Kundu, et al.,
bioRxiv - Bioengineering 2023
Quote:
... for 3 hours at room temperature in a peptide synthesis vessel (ChemGlass, Vineland, NJ). The peptide solution was filtered to remove the resin and the peptide was precipitated out using diethyl ether at -80°C ...
-
No products found
because this supplier's products are not listed.
Kelli K. Mullane, et al.,
bioRxiv - Microbiology 2022
Quote:
... in which a 5 mL glass serum vial (DWK Life Sciences, New Jersey ...
-
No products found
because this supplier's products are not listed.
Marie Ouarné, et al.,
bioRxiv - Cell Biology 2023
Quote:
... a stock of 50mg 5-ethynyl-2-deoxyuridine (EdU) (Alfagene, A10044) was diluted in 5mL of PBS to make a working solution (10mg/mL) ...
-
No products found
because this supplier's products are not listed.
Judit Vágó, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Equal amounts of protein (3 µg) were loaded into 12–230 kDa separation modules (Protein Simple, Bio-Techne ...
-
No products found
because this supplier's products are not listed.
Mary E. Herndon, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Endogenous peroxidase activity was quenched with 3% hydrogen peroxide and Background Buster (Innovex Biosciences; Richmond, CA) was used to block non-specific staining ...
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...
-
No products found
because this supplier's products are not listed.
Martina Ruglioni, et al.,
bioRxiv - Biophysics 2023
Quote:
Cells were seeded (3×105) in 35 mm glass-bottom dishes (WillCo Wells BV, Amsterdam, The Netherlands) with 2 ml of culture medium and maintained at 37°C and 5% CO2 for 24 prior to transfection (vide infra ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Biophysics 2024
Quote:
... Plasma Surface Technology) at 100 W for 3 min and then moved to a vacuum desiccator (Bel-Art F420220000 ...
-
No products found
because this supplier's products are not listed.
Maik Müller, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Peptides were C18-purified using 5–60 μg UltraMicroSpin Columns (The Nest Group, cat: SEMSS18V) according to manufacturer’s instructions and subjected for mass spectromic analysis using an Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Divine C. Nwafor, et al.,
bioRxiv - Neuroscience 2021
Quote:
... D3 cells were seeded onto 3 independent collagen-coated 16-well E-Plate PET arrays (ACEA Biosciences, San Diego, CA) at a concentration of 20,000 cells/well and loaded onto an xCelligence RTCA DP system (ACEA Biosciences ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Shiwei Liu, et al.,
bioRxiv - Genomics 2023
Quote:
... we grew parasites at 37°C in vitro at 3% hematocrit (serotype A positive human erythrocytes, Valley Biomedical, VA or BioIVT, NY) in RPMI 1640 medium (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Sophie E. Cousineau, et al.,
bioRxiv - Microbiology 2022
Quote:
... mouse anti-JFH-1 NS5A (clone 7B5, BioFront Technologies, 1:10,000). Blots were incubated for 1 hour with HRP-conjugated secondary antibodies diluted in 5% skim milk ...
-
No products found
because this supplier's products are not listed.
Mark E. Corkins, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... then moved to a 1.5ml tube containing 1:1 1xMMR:Optiprep (Cosmo Bio Usa Inc AXS1114542) with a glass pipette ...
-
No products found
because this supplier's products are not listed.
Rita F. Santos, et al.,
bioRxiv - Immunology 2022
Quote:
... for 1 h with 1 μg/ml of the sAg staphylococcal enterotoxin E (SEE) (Toxin Technologies). After 24 h of culture at 37 °C ...
-
No products found
because this supplier's products are not listed.
Alicia Ravens, et al.,
bioRxiv - Neuroscience 2024
Quote:
... on coverslips (No. 1, Bioscience Tools) coated overnight with 0.2 mg/mL poly-L-lysine (Sigma-Aldrich ...
-
Cat# AB-T080,
50 microliters,USD $330.0
Ask
Joël S. Bloch, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... the biotinylated samples were desalted into PBS and were mixed at a concentration of 5 μM with a 2.4-fold molar excess of Streptavidin-ZAP (Advanced Targeting Systems, Carlsbad, CA, USA). The mixture was incubated for 1h on ice before diluting it in PBS to a working concentration of 500 nM.
-
No products found
because this supplier's products are not listed.
Linglei Jiang, et al.,
bioRxiv - Immunology 2022
Quote:
... IgA (1:250, Brookwood Biomedical, AL, USA) or IgM (1:250 ...
-
No products found
because this supplier's products are not listed.
Sepiedeh Keshavarzi, et al.,
bioRxiv - Neuroscience 2021
Quote:
... submerged in 1 % Tergazyme (in distilled water, Alconox) for at least an hour ...
-
No products found
because this supplier's products are not listed.
Catherine Hume, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... 11-OH-THC and THC-COOH (at a known concentration of 10 ng/ml in 1:1 methanol and water; Cerilliant, Round Rock, TX, USA). Then samples were sonicated for 20-minutes to precipitate proteins ...