-
No products found
because this supplier's products are not listed.
Irene Julca, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
No products found
because this supplier's products are not listed.
Antonia Gurgone, et al.,
bioRxiv - Neuroscience 2022
Quote:
... animals were treated with the selective positive allosteric modulator (PAM) of mGluR5 3-cyano-N-(1,3-diphenyl-1H-pyrazol-5-yl)benzamide (CDPPB; Tocris, UK) that was diluted in saline solution containing 5-10% final concentration of DMSO and polyethylene glycol 400 (DMSO ...
-
No products found
because this supplier's products are not listed.
Camilla Drocco, et al.,
bioRxiv - Microbiology 2024
Quote:
... and methyl N-[2-[[1-(4-chlorophenyl)pyrazol-3-yl]oxymethyl]phenyl]-N-methoxycarbamate (i. e. pyraclostrobin, pesticide analytical standard, CAS 175013-18-0, supplier: Sigma-Aldrich, purity ≥ 98.0% ...
-
No products found
because this supplier's products are not listed.
Ludovica Iovino, et al.,
bioRxiv - Neuroscience 2022
Quote:
... were incubated for 10 min at 37 °C in the presence of 10 µM 2-amino-5,6,7,8-tetrahydro-4-(4-methoxyphenyl)-7-(naphthalen-1-yl)-5-oxo-4H-chromene-3-carbonitrile (UCPH-101; Abcam 120309, UK), a specific excitatory amino acid transporter 1 (EAAT1/Glast ...
-
No products found
because this supplier's products are not listed.
Jennifer A Rybak, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
No products found
because this supplier's products are not listed.
Alix Thomas, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 212-2 ([(11R)-2-methyl-11-(morpholin-4-ylmethyl)-9-oxa1-azatricyclo[6.3.1.04,12]dodeca-2,4(12),5,7-tetraen-3-yl]-naphthalen-1-ylmethanone) from Cayman Chemical were dissolved in dimethylsulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Solveigh C. Koeberle, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
No products found
because this supplier's products are not listed.
Theodoros Karantanos, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay (11465007001, Roche Diagnostics, Mannheim, Germany) was performed according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Thi Tuyet Trinh Phan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... MTT (3-(4,5-dimethylthiazol-2-yl-2, 5-diphenyl tetrazolium bromide)) was purchased from Alfa Aesar (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Simon Lind, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and AR-C118925 {5-[[5-(2,8-dimethyl-5H-dibenzo[a,d]cyclohepten-5-yl)-3,4-dihydro-2-oxo-4-thioxo-1(2H)-pyrimidinyl]methyl]-N-2H-tetrazol-5-yl-2-furancarboxamide} were obtained from Calbiochem-Merck Millipore (Billerica ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
No products found
because this supplier's products are not listed.
Peyton J. Spreacker, et al.,
bioRxiv - Biophysics 2022
Quote:
... 2H-54-DMPC and 2H-22-DHPC (Avanti Polar Lipids, Alabaster, AL) were used to minimize the lipid background in the methyl region of the NMR spectra.
-
No products found
because this supplier's products are not listed.
Benjamin C. Shaw, et al.,
bioRxiv - Molecular Biology 2022
Quote:
The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
No products found
because this supplier's products are not listed.
Hannah Elcocks, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
Cat# HY-33900-500 mg,
500 mg, USD $50.0
Ask
Irina V. Mikheyeva, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cells were stained with 300 µM 3-[[(7-Hydroxy-2-oxo-2H-1-benzopyran-3-yl)carbonyl]amino]-D-alanine hydrocholoride (HADA, MedChemExpress, Cat. #HY-131045/CS-0124027) and perfused with 0.85X PBS prior to the osmotic shock.
-
No products found
because this supplier's products are not listed.
He-Yun Hsiao, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
No products found
because this supplier's products are not listed.
Mary Lou P. Bailey, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were imaged on agarose pads (see below) containing 100nM 2-[5-(Adamantan-1-yl)-1H-indol-3-yl]acetic acid (“5-IAA”; TCI Product number A3390).
-
No products found
because this supplier's products are not listed.
Jane T. Jones, et al.,
bioRxiv - Microbiology 2023
Quote:
... XTT [2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide] solution (0.5 mg XTT/mL 1× PBS with 25 µM menadione) (XTT sodium salt, VWR) was added at 150 µl per well and incubated at 37 °C ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
Jana Hucklenbroich, et al.,
bioRxiv - Plant Biology 2021
Quote:
... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
Pericytes viability was assessed using the 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assay according to the manufacturer’s procedure (Cell Signaling Technology). Cells were plated at the appropriate concentration in 96-well plates under different experimental conditions ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Pattama Wiriyasermkul, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 50 μL of 1 mg/mL XTT (2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide) (Biotium) was mixed with 5 μL of 1.5 mg/mL phenazine methosulfate ...
-
No products found
because this supplier's products are not listed.
Guoqiang Wang, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Membranes were blocked in 5% milk for 2h prior to incubation with primary antibodies against TNC (1:1000; Santa Cruz), ITGB3 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Zhilei Zhao, David Tian, Carolyn S. McBride,
bioRxiv - Neuroscience 2020
Quote:
[2] GAL4d from pBPGAL4.1Uw (Addgene plasmid #26226)(Primers:ADdomain,forward,5’-caggcggccgccataTGCATGGATCCGCCAACTTC AACCAGAGTGG-3’, reverse, 5’-tatcgatagacgtca CTACTCCTTCTTTGGGTTCGG-3’; BD domain ...
-
No products found
because this supplier's products are not listed.
Emily C. Britt, Jing Fan,
bioRxiv - Biochemistry 2020
Quote:
... and 3-2H-glucose (all from Cambridge Isotope), the isotopically labeled glucose was substituted for unlabeled glucose at the same concentration in RPMI culture media ...
-
No products found
because this supplier's products are not listed.
Hua Li, et al.,
bioRxiv - Cell Biology 2020
Quote:
... was amplified by PCR using the primers (5’-GGTTCCGCGTGGATCCATGTCTCATGCAGCCGAGCCA-3’ and 5’-GGAATTCCGGGGATCCTCAGGACTCCTCTTCAATGCTGA-3’) and cloned into BamHI site of pGEX-4T-1 expression vector (GE Healthcare) using In-Fusion HD Cloning System (Clontech) ...
-
No products found
because this supplier's products are not listed.
Martineau Éric, et al.,
bioRxiv - Neuroscience 2020
Quote:
... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent ...
-
No products found
because this supplier's products are not listed.
Kathleen E. McGrath, et al.,
bioRxiv - Cell Biology 2024
Quote:
... IL-3 (5 ng/ml, Peprotech), and cholesterol-rich lipids (40 mg/mL ...
-
No products found
because this supplier's products are not listed.
Maximilian Gantz, et al.,
bioRxiv - Synthetic Biology 2024
Quote:
... The emulsion of collected droplets was broken by adding 1H,1H,2H-2H-Perfluoro-octanol in a 1:1 (v/v) ratio with HFE-7500 (3M) and 100 µl 2 ng/µl salmon sperm DNA (Thermo) ...
-
No products found
because this supplier's products are not listed.
Caixia Su, et al.,
bioRxiv - Immunology 2023
Quote:
... The diluted detection antibody (1:1000) (MABTECH,3321-2H) was added and the plate was incubated at room temperature for 2h ...
-
No products found
because this supplier's products are not listed.
Ingo Amm, et al.,
bioRxiv - Cell Biology 2022
Quote:
... were mixed 1:1 with liposomes (5 mg/ml) and floated for 2h at 55,000 rpm in a TLS-55 rotor (Beckman) at 25 °C through a sucrose gradient ...
-
No products found
because this supplier's products are not listed.
Nicholas A. W. Bell, et al.,
bioRxiv - Biophysics 2020
Quote:
... of λ-DNA using the following primers: 5’-CGAACTCTTCAAATTCTTCTTCCA-3’ and 5’-GATTGCTCTTCTGTAAGGTTTTG-3’ with a 5:1 ratio of dTTP:biotin-11-dUTP (Jena Bioscience). Similarly ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Umit Akkose, et al.,
bioRxiv - Genomics 2020
Quote:
... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
No products found
because this supplier's products are not listed.
Tamara Vasilkovska, et al.,
bioRxiv - Neuroscience 2023
Quote:
... an additional subsequent 2h incubation with Lectin-Dylight 488 (1:25, Vector Laboratories, Cat. # DL-1174). After washing ...
-
No products found
because this supplier's products are not listed.
Katarzyna M. Luda, et al.,
bioRxiv - Immunology 2022
Quote:
... for 2h and with Brefeldin A (5ug/ml, Biolegend) added for the last 2h of stimulation prior surface staining ...
-
No products found
because this supplier's products are not listed.
Katarzyna Wacnik, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 µl of 1 M NaOH and 6 µl of Cell-Tak (Corning, 5% (w/v) in acetic acid ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
Danny Galleguillos, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and N-[(1R,2R)-1-(2,3-Dihydrobenzo[b][1,4]dioxin-6-yl)-1-hydroxy-3- (pyrrolidin-1-yl)propan 2-yl] nonanamide (GENZ-123346) was obtained from Toronto Research Chemicals (TRC G363450) and solubilized in DMSO ...
-
No products found
because this supplier's products are not listed.
Yihe Huang, Wei Lü, Juan Du,
bioRxiv - Biophysics 2023
Quote:
... For nanodisc samples, 0.5 mM (1H, 1H, 2H, 2H-Perfluorooctyl)-β-D- Maltopyranoside (FOM, Anatrace) was added for improving particles distribution and contrast ...
-
No products found
because this supplier's products are not listed.
Dhiraj Kumar Singh, et al.,
bioRxiv - Immunology 2020
Quote:
... Antihuman ACE-2 (R&D Systems, USA, 1:50, 2h at 37°C) was used for identification of ACE-2 ...
-
No products found
because this supplier's products are not listed.
Lyra O. Randzavola, et al.,
bioRxiv - Immunology 2022
Quote:
... and treated for 2h with ATP (2.5mM, Invivogen). Supernatants were harvested and subjected to Caspase-Glo 1 inflammasome assay following manufacturer’s protocol (G9951 ...
-
No products found
because this supplier's products are not listed.
Ewa Sitarska, et al.,
bioRxiv - Cell Biology 2021
Quote:
... they were postfixed for 2h on ice in freshly prepared and filtered 1% OsO4 (#19190, EMS) and 0,8% potassium ferrocyanide (K4[Fe(CN)6]*3H2O ...
-
No products found
because this supplier's products are not listed.
Neil Fleck, Christoph Grundner,
bioRxiv - Genetics 2021
Quote:
... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
No products found
because this supplier's products are not listed.
Kemin Tan, et al.,
bioRxiv - Immunology 2023
Quote:
... Co- transfection of those plasmids were performed at a density of 4-5 million cells/mL in a 1:3 ratio (weight: weight) of plasmids to PEImax at 1 mg/ml (Polysciences). Following a 4-day incubation ...
-
No products found
because this supplier's products are not listed.
Emily Nicole Powers, et al.,
bioRxiv - Genetics 2022
Quote:
... and either an anti-rat secondary antibody conjugated to IR Dye 680 (RRID:AB_10956590) at a 1:15,000 dilution at room temperature for 1-2h (LI-COR Biosciences). Immunoblot images were generated and quantified using the Odyssey system (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
Dairui Li, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Cells were passaged every 3–5 days with ReLeSR (STEMCELL Technologies). All cells used had a normal diploid karyotype.