-
No products found
because this supplier's products are not listed.
Shan Qi, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 µM [methyl-3H] S-adenosyl methionine (PerkinElmer), 10 µM substrate RNA/DNA probe ...
-
No products found
because this supplier's products are not listed.
Indrani Basu, et al.,
bioRxiv - Cell Biology 2021
Quote:
... were reared in 10g/l of glucose/200µM of 3BDO (3-Benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2(3H)-one) (Sigma Aldrich) supplemented in standard fly food ...
-
No products found
because this supplier's products are not listed.
Patrick C. Kerstein, et al.,
bioRxiv - Neuroscience 2020
Quote:
... (S)-1-(2-Amino-2-carboxyethyl)-3-(2-carboxy-5-phenylthiophene-3-yl-methyl)-5-methylpyrimidine-2,4-dione (ACET; 1μM; Tocris Bioscience, catalog #2728).
-
No products found
because this supplier's products are not listed.
H. Hendrix, et al.,
bioRxiv - Microbiology 2019
Quote:
... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Gengyang Yuan, et al.,
bioRxiv - Neuroscience 2021
Quote:
20 μL [3H]Methyl iodide in DMF (American Radiolabeled Chemicals, Inc. ...
-
No products found
because this supplier's products are not listed.
Patrick T Griffin, et al.,
bioRxiv - Genomics 2022
Quote:
... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
No products found
because this supplier's products are not listed.
Marlys S. Fassett, et al.,
bioRxiv - Immunology 2021
Quote:
... α-methyl-5-hydroxytryptamine (500 μg; Abcam), and endothelin-1 (10 pmol ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Michael A. Funk, et al.,
bioRxiv - Biochemistry 2021
Quote:
... [2,8-3H]-ATP tetraammonium salt and [methyl-3H]-TTP tetraammonium salt of high activity were obtained from Moravek Biochemicals and added to freshly prepared ...
-
No products found
because this supplier's products are not listed.
Sebastian Duno-Miranda, et al.,
bioRxiv - Molecular Biology 2023
Quote:
The fluorescence of 3’-O-(N-Methyl-anthraniloyl)-2’-deoxyadenosine-5’-triphosphate (mantATP) (Jena Biosciences) was measured with 290 nm excitation and a 395 nm long-pass emission filter in a stopped-flow apparatus (Applied Photophysics ...
-
No products found
because this supplier's products are not listed.
Evan P.S. Pratt, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 8MM-IBMX (3-Isobutyl-8-(methoxymethyl)-1-methyl-1H-purine-2,6(3H,7H)-dione) was purchased from Santa Cruz Biotechnology (Dallas ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
No products found
because this supplier's products are not listed.
Mariam Lotfy Khaled, et al.,
bioRxiv - Cancer Biology 2023
Quote:
3-methyl-2-oxovaleric acid sodium salt (KMV) (Toronto Research Chemical), 4-methyl-2-oxovaleric acid (KIC ...
-
No products found
because this supplier's products are not listed.
Tuan Minh Tran, et al.,
bioRxiv - Plant Biology 2020
Quote:
DSF (cis-11-methyl-2-dodecenonic) was purchased from Merck and dissolved in DMSO to obtain 100 mM stock ...
-
No products found
because this supplier's products are not listed.
Yuta Kudo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Methyl 3-oxoheptanoate (TCI America, 790 mg, 5 mmol) was dissolved in 6 mL of aqueous 3.0 M NaOH and 300 μL of tetrahydrofuran ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1-[2-chloro-6-[[(3-iodophenyl)methyl]amino]-9H-purin-9-yl]-1-deoxy-N-methyl-β-D-ribofuranuronamide (2-Chloro-IB-MECA; Cayman Chemicals, 163042-96-4), [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171 ...
-
No products found
because this supplier's products are not listed.
Axel de Baat, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Supernatants were collected and phosphorylated 2-(3H) deoxyglucose was separated by Poly-Prep columns (BioRad). The final eluates were mixed with Ultima Gold Scintillation fluid at a 1:7 Ratio in scintillation tubes and analysed with a beta counter.
-
No products found
because this supplier's products are not listed.
Helena Shomar, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
2-methyl tryptophan was quantified by an LC-MS system (Agilent) using an XBridge BEH Amide 2.5 μm (Waters ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
Dynamic PET/CT imaging (2-3h) with arterial blood sampling was performed on Monkey 3 and Monkey 4 using a Discovery MI (GE Healthcare). Each animal had two baseline scans which were separated by one month for Monkey 3 and by one year for Monkey 4 ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Dougald M. Monroe, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4 μM lipid vesicles (Avanti Polar Lipids PS:PC:PE 3:2:5), and FV (0 ...
-
No products found
because this supplier's products are not listed.
Laura Miguel-Romero, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
No products found
because this supplier's products are not listed.
Daniel F. Comiskey Jr., et al.,
bioRxiv - Cancer Biology 2019
Quote:
2’O-methyl SSOs were provided by Trilink BioTechnologies ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Ashley N. Anderson, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by 3 x 5 minute washes in 2 × SSC (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Bethany A Stahl, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Embryos were mounted in 3% hydroxypropyl methyl cellulose (VWR, cat# 200012-722) in E3 medium (ref) ...
-
No products found
because this supplier's products are not listed.
Kathleen E. McGrath, et al.,
bioRxiv - Cell Biology 2024
Quote:
... IL-3 (5 ng/ml, Peprotech), and cholesterol-rich lipids (40 mg/mL ...
-
No products found
because this supplier's products are not listed.
Tereza Kořánová, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PAK1/2/3 (Cell Signaling, #2604), and β-actin (Sigma–Aldrich ...
-
No products found
because this supplier's products are not listed.
Simon Lind, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and AR-C118925 {5-[[5-(2,8-dimethyl-5H-dibenzo[a,d]cyclohepten-5-yl)-3,4-dihydro-2-oxo-4-thioxo-1(2H)-pyrimidinyl]methyl]-N-2H-tetrazol-5-yl-2-furancarboxamide} were obtained from Calbiochem-Merck Millipore (Billerica ...
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Aleeza C. Gerstein, et al.,
bioRxiv - Genetics 2019
Quote:
... 0.15 μM myo-[2-3H]-inositol (1 μCi/μl; MP BioMedicals). Additional 200 μM unlabeled inositol (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Chloé Geoffroy, et al.,
bioRxiv - Neuroscience 2023
Quote:
... D-APV (D-(-)-2-Amino-5-phosphonopentanoic acid) and N-methyl-D-aspartate from HelloBio (County Meath, ROI) and gentamycin from GIBCO (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Thi Tuyet Trinh Phan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... MTT (3-(4,5-dimethylthiazol-2-yl-2, 5-diphenyl tetrazolium bromide)) was purchased from Alfa Aesar (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Trinovita Andraini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3-(2,4-Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone (BML-CM127-0050, Enzo Life Sciences) was injected at 20mg/kg (in 10% DMSO ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Laura Micheli, et al.,
bioRxiv - Neuroscience 2021
Quote:
... PlGF-2 (3 – 30 ng; 5 µl; cat.465-PL/CF, R&D System, USA), VEGF-E (3 – 30 ng ...
-
No products found
because this supplier's products are not listed.
Maude Jans, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Fixative was removed by washing 5 x 3 min in 0.1 M cacodylate buffer and samples were incubated in 2% osmium (OsO4, EMS) in 0.1 M cacodylate buffer for 30 min at RT ...
-
No products found
because this supplier's products are not listed.
Deepraj Sarmah, et al.,
bioRxiv - Systems Biology 2022
Quote:
... The cells were cultured at 37°C in 5% CO2 in a humidified incubator and passaged every 2-3 days with 0.05% trypsin (Corning #25-052-Cl) to maintain sub confluency.
-
Cat# HY-W010553-500 mg,
500 mg, USD $50.0
Ask
Evan P.S. Pratt, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... PF-04957325 (3-[[(2R)-4-(1,3-thiazol-2-ylmethyl)morpholin-2-yl]methyl]-5-(trifluoromethyl)triazolo[4,5-d]pyrimidin-7-amine) was purchased from MedChemExpress (Monmouth Junction, NJ). Unless otherwise indicated ...
-
No products found
because this supplier's products are not listed.
Bryan Gutierrez, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Tris(3-hydroxypropyltriazolyl-methyl)amine (THPTA) was purchased from Click Chemistry Tools. 1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Shreya Narasimhan, Brian J. Schriver, Qi Wang,
bioRxiv - Neuroscience 2022
Quote:
... Behavioral studies were conducted using 5 female rats (3 Long Evans and 2 Sprague Dawley, Charles River Laboratories ...
-
No products found
because this supplier's products are not listed.
Gaoyang Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Luna C18(2) C8 column (3 μm, 2 mm × 50 mm, Phenomenex) was used ...