-
No products found
because this supplier's products are not listed.
Lucia Sedlackova, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM NR (ChromaDex), 10 μM olaparib (Cambridge Biosciences) ...
-
No products found
because this supplier's products are not listed.
Paola Moreno-Roman, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5% NGS (Capralogics GS0250), washed 3 times in PBT ...
-
No products found
because this supplier's products are not listed.
Karl Alex Hedin, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... for preventing bacterial growth and 1 g/L 5-Fluoroorotic Acid (5-FOA; Nordic BioSite) for preventing other yeast species from growing.
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... We further compared neurons cultured in patterning versus maturation medium using 5 μl/ml BDNF and 5 μl/ml GDNF slow release PLGA microbeads (StemCultures; 5 ng/ml steady-state concentrations) at two time points ...
-
No products found
because this supplier's products are not listed.
David T. Han, Weichen Zhao, Wade H. Powell,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 1999) and 1 GRE (5’AGAACAGT3’ > 5’TAGCATCT3’) were generated by site-directed mutagenesis (Epoch Life Sciences). Transactivation Assays ...
-
No products found
because this supplier's products are not listed.
Rueyhung R. Weng, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5% human platelet lysate (PLS1, Compass Biomedical), 70 ng/mL IL-15 (AF-200-15 ...
-
No products found
because this supplier's products are not listed.
Deirdre Nolfi-Donegan, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ADP (0-5 μM; Bio/Data Corporation), collagen (0-50 μg/ml ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
... RPA at 5 μM (ME043.1, Squarix biotechnology), MitoTracker Green at 75 nM (M7514 ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and 5% BriClone Hybridoma Cloning Medium (QED Bioscience). One hundred units/ml penicillin ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Jaylissa Torres Robles, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Samples were boiled at 95ºC for 5 min and fractionated on 5% SDS-polyacrylamide gels with 25 nM Phos-tag reagent (Nard Institute AAL-107) and 50 μM MnCl2 as reported previously78 or by standard SDS-PAGE ...
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... the Fe with 1wt% VH precursor mixture was loaded into a custom-build consolidation die and high-pressure cold-sintered at 2.5 GPa (corresponding to 5 t for 5 mm diameter die) and RT using manual press (Carver, Wabash, IN, USA) to obtain the drug-loaded metal (Supplementary Materials ...
-
No products found
because this supplier's products are not listed.
Telmo A. Catarino, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... or LPS (1:100, WN1 222-5, Hycult Biotech) at 4 ° C ...
-
No products found
because this supplier's products are not listed.
Andrew R Harris, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 5% biotinyl-amino-PEG (Rapp Polymere, #13 3000-25-20) which was incubated for a minimum of 4 hours at 50°C ...
-
No products found
because this supplier's products are not listed.
Daniel Lyngholm, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 5-10nl of red or green fluorescent latex microspheres (Lumafluor, USA) (Katz et al. ...
-
No products found
because this supplier's products are not listed.
Andreas I. Andreou, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 2.5 μM DEX (Acros) or 5 μM β-estradiol (LKT laboratories) were added.
-
No products found
because this supplier's products are not listed.
Honglin Jiang, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... A final concentration of 5 uM of SiRhoNox (FerroFarRed, GORYO Chemical) in a serum-free culture medium was added to the dish and incubate for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 1 µg of DNA were transfected using 5 µl Geneporter2 (Genlantis) or 1.5 µl Lipofectamine 2000 (Thermo Fisher).
-
No products found
because this supplier's products are not listed.
Marie Ouarné, et al.,
bioRxiv - Cell Biology 2023
Quote:
... a stock of 50mg 5-ethynyl-2-deoxyuridine (EdU) (Alfagene, A10044) was diluted in 5mL of PBS to make a working solution (10mg/mL) ...
-
No products found
because this supplier's products are not listed.
Abrar Choudhury, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... whole skulls were subsequently embedded in 5% low-melt agarose (Precisionary) and cut into 300µm sections on a Vibratome (VT1000S ...
-
No products found
because this supplier's products are not listed.
Jack George, Howard T. Jacobs,
bioRxiv - Molecular Biology 2019
Quote:
... Membranes were blocked in 5% nonfat milk in PBS-0.05% Tween (Medicago) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Adam T. Hilterbrand, et al.,
bioRxiv - Microbiology 2021
Quote:
... 250 ug/ml G418 and 5 ug/ml of puromycin (AG Scientific). CHO-nectin-1 cells were a gift from Richard Longnecker (Northwestern University) ...
-
No products found
because this supplier's products are not listed.
Tsuyoshi Waku, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... After the treatment with 5 nM or 10 nM bortezomib (BTZ, Peptide Institute), the cells were stained by Trypan Blue and automatically counted using a TC20 Automated Cell Counter (Bio-Rad Laboratories).
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Hisayoshi Kubota, et al.,
bioRxiv - Neuroscience 2022
Quote:
... sections were blocked with 5% fetal bovine serum (Nichirei Bioscience Inc., Tokyo, Japan) in PBST for 2 h and then incubated with primary antibodies in PBST at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Kazuya Matsuo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Human frozen brain sections (5–10 μm thickness) were obtained from BioChain Institute and a part of them were treated with RNase A ...
-
No products found
because this supplier's products are not listed.
Alasdair TM Hubbard, et al.,
bioRxiv - Microbiology 2019
Quote:
... at 5 × 105 cells per ml in CnT-Prime medium (CnT-PR, CELLnTEC, Switzerland). An appropriate amount of CnT-PR was added to the basolateral chamber of the inserts so that the medium levels were equal ...
-
No products found
because this supplier's products are not listed.
Elena A. Andreeva, et al.,
bioRxiv - Biophysics 2022
Quote:
... the protein solution (∼ 5 ml) was circulated with a peristaltic pump (Gilson Minipuls 3) through a 2 mm X-ray quartz capillary in a closed loop ...
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Lindsay Smith, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... zebrafish were incubated for 5 min at 28.5°C with optovin 6b8 (ID 5705191l; ChemBridge), an optovin analog (Kokel et al. ...
-
No products found
because this supplier's products are not listed.
Elizaveta O. Boldinova, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Primer-18 was 5′-labeled with [γ-32P]-ATP by T4 polynucleotide kinase (SibEnzyme, Russia) and annealed to the corresponding unlabeled Template-55 at a molar ratio of 1:1.1 ...
-
No products found
because this supplier's products are not listed.
Denzil Furtado, et al.,
bioRxiv - Bioengineering 2022
Quote:
... fibroblasts were switched to DMEM supplemented with 5% fetal bovine lipoprotein deficient serum (Alpha Diagnostic International), 100 U/ml penicillin and 100 μg/ml streptomycin ...
-
No products found
because this supplier's products are not listed.
Markus Hackl, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The NTA modified primer (backward primer, 5’-NTA-SS-C6-TCCAAAGGTGAAGAACTGTTCACC) was purchased from Gene Link, Inc ...
-
No products found
because this supplier's products are not listed.
Thomas W Jackson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 5 μl of Proteinase K (20 mg/ml; Viagen Biotech, Los Angeles, CA; Cat: 501-PK) were added to the biopsy sample ...
-
No products found
because this supplier's products are not listed.
Geoffrey A. Smith, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were washed and then treated with 5 µg/ml 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI) labeled LDL (Kalen Biomedical) in low-glucose DMEM with 0.5% BSA (MilliporeSigma ...
-
No products found
because this supplier's products are not listed.
Amber M. Johnson, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... After blocking with 10% goat serum in equal parts of 5% BSA in TBST and Superblock (ScyTek Laboratories, AAA999) at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Christina Schmid, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... were centrifuged (180 x g for 5 min) and resuspended in Plating Medium (Fujifilm Cellular Dynamics, Madison, WI, USA). Cells were seeded into fibronectin-coated (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Livio Dukaj, Nicholas Rhind,
bioRxiv - Cell Biology 2020
Quote:
... cultures were vacuum-filtered and cells were resuspended in fresh YPD supplemented with 5 µg/ml α-factor (Biomatik) and auxin to a final concentration of 500 µM ...
-
No products found
because this supplier's products are not listed.
Bruno Raposo, et al.,
bioRxiv - Immunology 2022
Quote:
... transfer of 1.5 mg per mouse of a 5 monoclonal anti-type II collagen (CII) antibody cocktail (Chondrex, USA). 3 days later ...
-
No products found
because this supplier's products are not listed.
Marie F.A. Cutiongco, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Gene expression was measured directly from 5 ng RNA using a one-step RT PCR kit with SYBR dye (PrimerDesign). qPCR was run on the BioRad CFX96 platform ...
-
No products found
because this supplier's products are not listed.
Callie P. Wigington, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5-6 mg of lysate was used for pull-downs with 30 μl of GFP-Trap magnetic beads (Bulldog Bio. Inc.) in binding buffer (50 mM Tris-HCl pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Maria Kuzikov, et al.,
bioRxiv - Molecular Biology 2023
Quote:
5 µl/ 100 nM of USP7/USP14 (BPS bioscience, #80364) were added to assay plates containing the compounds ...
-
No products found
because this supplier's products are not listed.
Ranmal A. Samarasinghe, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Papain was resuspended in 5 ml Hibernate E medium (Brainbits, #HE) containing N2 and B27 supplements (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Dávid Kovács, et al.,
bioRxiv - Cell Biology 2021
Quote:
... completed with 5% foetal bovine serum and 1% ZellShield (Minerva Biolabs). A549 cells were maintained in Dulbecco’s Modified Eeagle’s Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Xiaona Chen, et al.,
bioRxiv - Cell Biology 2020
Quote:
... gastrocnemius and quadriceps muscles were injected with CTX (Latoxan; 10−5 M). At the indicated time points (3- and 7-day post injury) ...
-
No products found
because this supplier's products are not listed.
Allison R. Fusilier, et al.,
bioRxiv - Neuroscience 2021
Quote:
... BMAL1 (1:1000 in 5% BSA and TBST, Signalway Antibody, LLC, #21415,), GSK3β (3D10 ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... followed by 5 days of decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Alexandre Champroux, et al.,
bioRxiv - Genetics 2023
Quote:
... each 35.5 cm long and 5 cm wide (Campden Instruments Ltd, Lafayette, IN). General mouse activity was analyzed for 5 min ...
-
No products found
because this supplier's products are not listed.
Joseph C. Reynolds, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Membranes were blocked for 1 hour using 5% BSA (Akron Biotech, USA, #AK8905-0100) in tris-buffered saline containing 0.05% Tween-20 (Bio-Rad #161-0781 ...