-
No products found
because this supplier's products are not listed.
Dominique Massey-Harroche, et al.,
bioRxiv - Cell Biology 2023
Quote:
... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
No products found
because this supplier's products are not listed.
Giovannino Silvestri, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... 5 μM 5-Aza-2′-deoxycytidine (5-Aza; Sigma), 250-500 nM CpG-scramble ...
-
No products found
because this supplier's products are not listed.
Sumera Perveen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... m7G(5′)ppp(5′)G (NEB, #S1404S) and m7G(5′)ppp(5′)A (NEB ...
-
No products found
because this supplier's products are not listed.
Gregor Diensthuber, et al.,
bioRxiv - Genomics 2023
Quote:
... using 5-Methyluridine-5’-Triphosphate (5-mUTP, Trilink, N-1024-1) instead of UTP ...
-
No products found
because this supplier's products are not listed.
Dillon G. Patterson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5 ng/ml IL-5 (Biolegend; 581504), and 20 ng/ml IL-2 (Biolegend ...
-
No products found
because this supplier's products are not listed.
Bideep Shrestha, Milla Tallila, Olli Matilainen,
bioRxiv - Genetics 2023
Quote:
... and 5-methyltetrahydrofolate (5-MTHF, Merck, #M0132) were added to NMG media at indicated concentrations ...
-
No products found
because this supplier's products are not listed.
Christopher Douglas, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Guilherme S. Hentschke, et al.,
bioRxiv - Microbiology 2021
Quote:
... 5 μl 5× Buffer (Promega), 2 μl MgCl2 (25mM) ...
-
No products found
because this supplier's products are not listed.
Gisela Cairo, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5-Iodotubercidin (5-Itu; Cayman Chemicals; 0.5μM) was used to inhibit haspin kinase with ethanol (Fisher ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
No products found
because this supplier's products are not listed.
Mélanie Rogier, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-5 (5 ng/ml, R&D Systems), TGF-β (3 ng/ml ...
-
No products found
because this supplier's products are not listed.
Buki Kwon, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 5’ RACE was performed with the 5’ RACE kit (Roche) using gene-specific reverse primers ...
-
No products found
because this supplier's products are not listed.
Shawna K. Brookens, et al.,
bioRxiv - Immunology 2023
Quote:
... 5 ng/mL IL-5 (Peprotech), and 50 nM 4-hydroxy-tamoxifen (4-OHT ...
-
No products found
because this supplier's products are not listed.
Blake A. Caldwell, Yajun Wu, Jing Wang, Liwu Li,
bioRxiv - Immunology 2023
Quote:
... For 5-azacytidine (5-aza; Stem Cell Technologies) and trehalose 6,6’-dimycolate (TDM ...
-
No products found
because this supplier's products are not listed.
Eri Hirata, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 5-Fluoroorotic acid (5-FOA; ZYMO RESEARCH F9003), or doxycycline (Sigma D9891) ...
-
No products found
because this supplier's products are not listed.
Maria L. White, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5 (BioTek). OD600nm readings were taken every hour and growth curves were plotted using GraphPad Prism 9.
-
No products found
because this supplier's products are not listed.
Hritika Sharma, Anjali Bose, Uma Kumar, Rahul Pal,
bioRxiv - Immunology 2020
Quote:
... LPS (5 µg/ml) or LPS (5 µg/ml) + concanavalin A (5 μg/ml; InvivoGen) were employed as control stimulants for splenocytes and isolated cells respectively.
-
No products found
because this supplier's products are not listed.
Ellen M. Bouma, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5-nonyloxytryptamine oxalate (5-NT) (Tocris, Bristol, United Kingdom) was diluted to a 5mM stock concentration in DMSO (Merck) ...
-
No products found
because this supplier's products are not listed.
Nicanor Obaldía III, et al.,
bioRxiv - Microbiology 2023
Quote:
... 17µl (∼ 5 µg) of each Cy-5-labelled (GE Healthcare) cDNA of the sample and an equal amount of Cy-3-labelled (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Paula F. Zamora, et al.,
bioRxiv - Microbiology 2024
Quote:
... and 5 U/ml penicillin-5 mg/ml streptomycin (Corning) in adherent cell culture conditions at 37°C with 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Raphaël Forquet, et al.,
bioRxiv - Microbiology 2021
Quote:
... 5’PPP structures were then converted into 5’P ends using RNA 5’ Polyphosphatase (5’PP, Epicentre), to which RNA adapters were ligated ...
-
No products found
because this supplier's products are not listed.
Huan Peng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 5-bromosalicylic acid (5-BAA) (>98.0%; TCI), isopropyl β-D-1- thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Kirandeep K. Deol, et al.,
bioRxiv - Biochemistry 2020
Quote:
Adenosine-5’-triphosphate (Goldbio, Cat. # A-081-5)
-
No products found
because this supplier's products are not listed.
Poppy Datta, et al.,
bioRxiv - Cell Biology 2019
Quote:
... blocked with 5% BSA/5% normal goat serum (Vector Laboratories) in PBS-T ...
-
No products found
because this supplier's products are not listed.
Aaron I. Weiner, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... + 5% Matrigel (BD) for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Binliang Tang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... α5 (Abcam, ab175195), β2 (Abcam ...
-
No products found
because this supplier's products are not listed.
Tommaso Virgilio, et al.,
bioRxiv - Immunology 2021
Quote:
... BSA 5% (VWR) and fluorescently labelled antibodies at proper concentration ...
-
No products found
because this supplier's products are not listed.
Kara Anazia, et al.,
bioRxiv - Biophysics 2024
Quote:
... 5% acrylamide (BIORAD), 0.1% SDS ...
-
No products found
because this supplier's products are not listed.
Ekaterina Petrova, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 5 µm (Agilent). Next ...
-
No products found
because this supplier's products are not listed.
Hattie Chung, et al.,
bioRxiv - Genomics 2021
Quote:
... 5% normal donkey serum and 5% normal goat serum (Jackson Immunoresearch) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Amy J. Gleichman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
No products found
because this supplier's products are not listed.
Arya Bagus Boedi Iswanto, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 5 µM FB1 (Santa Cruz), 50 µM PDMP (Santa Cruz) ...
-
No products found
because this supplier's products are not listed.
Ons Mamai, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-pSMAD1/5 (Cell Signaling), anti-SMAD4 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Johnathan Abou-Fadel, et al.,
bioRxiv - Systems Biology 2019
Quote:
... 5 µm (Phenomenex) column ...
-
No products found
because this supplier's products are not listed.
Régis E Meyer, et al.,
bioRxiv - Cell Biology 2020
Quote:
... or 1-NMPP1 (5 μM, Calbiochem; 5 mM stock in dimethylsulfoxide) were added to the medium at the time of prophase exit ...
-
No products found
because this supplier's products are not listed.
Evan M. Hess, et al.,
bioRxiv - Neuroscience 2022
Quote:
... supplemented with 5% fetal bovine serum/5% horse serum (Atlanta Biologicals), Glutamax (Gibco) ...
-
No products found
because this supplier's products are not listed.
Jin Luo, et al.,
bioRxiv - Microbiology 2020
Quote:
... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
No products found
because this supplier's products are not listed.
Daisuke Tone, et al.,
bioRxiv - Neuroscience 2021
Quote:
... or 3.3 mM (Figure 5-figure supplement 1 and 8) ATP and 5 µM ProfilerPro Kinase Peptide Substrate 11 5-FAM-KKLNRTLSVA-COOH (PerkinElmer, U.S.A.), in the presence or absence of 0.66 µM CaM (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Giulia Ferrari, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5% CO2 in EGM1 (Lonza) on 1% gelatin-coated flasks (Sigma) ...
-
No products found
because this supplier's products are not listed.
Gabriel S. Jensen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stellaris 5 (Leica), or LSM 900 (Zeiss ...
-
No products found
because this supplier's products are not listed.
Alexandros Sfikas, et al.,
bioRxiv - Cell Biology 2019
Quote:
... siRNA 2 5’ GCCCUAUCCCUUUACGUCA (Eurogentec). Dharmacon ONTarget plus SMARTpool ...
-
Cat# HY-W017523,
inquire
Ask
Kruno Vukušić, Iva M. Tolić,
bioRxiv - Cell Biology 2023
Quote:
... Haspin inhibitor 5-Iodotubercidin (5-ITu) (MedChemExpress, IC50 value 5-9 nM ...
-
No products found
because this supplier's products are not listed.
Christian Franke, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 5 % CO2 (Eppendorf). Jurkat CD4-KO cells were derived from wild-type Jurkat T cells (clone E6 ...
-
5-Hydroxytryptophan (5-HTP, NSC-92523), also known as oxitriptan (INN), is a naturally occurring...
Cat# S2374, SKU# S2374-50mg,
50mg, $210.00
Ask
Marc A. Vittoria, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5-10 µM (Selleck Chemicals); RACi ...
-
No products found
because this supplier's products are not listed.
Denzil Furtado, et al.,
bioRxiv - Bioengineering 2022
Quote:
... or 5-methoxyuridine 5’-triphosphate (5moUTP, APExBIO), and cytidine 5’-triphosphate (CTP ...
-
No products found
because this supplier's products are not listed.
Marvin A. Ssemadaali, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... Transporter 5™ reagent (Polysciences, Inc, Cat #26008-5) was used to transfect parental HEK293T/17 cells ...
-
No products found
because this supplier's products are not listed.
Su-Juan Liu, et al.,
bioRxiv - Microbiology 2023
Quote:
The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
No products found
because this supplier's products are not listed.
Andrea Rizzotto, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and 5 μL of 5 μg/mL Propidium Iodide (Biotium) for cell death detection ...
-
No products found
because this supplier's products are not listed.
Dixcy Jaba Sheeba John Mary, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... 5-azacytidine (5-aza) was procured from MP Biomedicals (Solon, USA). 17β-estradiol (E2 ...
-
No products found
because this supplier's products are not listed.
Trisha A. Macrae, Miguel Ramalho-Santos,
bioRxiv - Molecular Biology 2020
Quote:
... 5 min total (Diagenode).