-
No products found
because this supplier's products are not listed.
Cynthia M. Arokiaraj, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Cyanine 3 and Cyanine 5 reagents from Akoya Biosciences at 1:1500 ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
Asya Smirnov, et al.,
bioRxiv - Microbiology 2022
Quote:
... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
No products found
because this supplier's products are not listed.
Lauren Rice, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 5% (v/v) (3-Aminopropyl) triethoxysilane (APTES) (98%, Alfa Aesar, USA) was added to coverslips in Milli-Q water and incubated for 15 min ...
-
No products found
because this supplier's products are not listed.
Moussira Alameddine, et al.,
bioRxiv - Physiology 2023
Quote:
... 3 months (3M), 18 months (18M ...
-
No products found
because this supplier's products are not listed.
Patrick A. Carroll, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... anti-TXNIP (WB and IF, K0204-3, K0205-3, MBL International), anti-PGK1/2 (WB and IF ...
-
ADAMTS-5 inhibitor
Sold for research purposes only.
Cat# 2083.0, SKU# 2083-25 mg,
25mg, US $539.00 / EA, EURO, €490 / EA
Ask
Edinson Lucumi Moreno, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3 M CHIR (Axon Medchem) and 150 M Ascorbic Acid (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
Yuta Kudo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Methyl 3-oxoheptanoate (TCI America, 790 mg, 5 mmol) was dissolved in 6 mL of aqueous 3.0 M NaOH and 300 μL of tetrahydrofuran ...
-
No products found
because this supplier's products are not listed.
Eric E. Irons, et al.,
bioRxiv - Immunology 2019
Quote:
... IL-3 (5ng/ml; BioVision), TPO (25ng/ml ...
-
No products found
because this supplier's products are not listed.
Alison L. Wong, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3% paraformalydehyde (15754-S, EMS) and 0.1 M Sorensen’s phosphate buffer pH 7.2 solution ...
-
No products found
because this supplier's products are not listed.
Annelot C. M. van Esbroeck, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... After rinsing the membrane with TBS-T (3 × 5 min) and TBS (3 × 5 min) fluorescence was detected by scanning on the Odyssey CLx (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
X. Rosa Ma, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
No products found
because this supplier's products are not listed.
Max D. Knickmeyer, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Embryos were examined at 3-5 dpf using a stereomicroscope (Nikon SMZ18) with a light source for fluorescence ...
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
N Hammoudi, et al.,
bioRxiv - Microbiology 2020
Quote:
... Tube underwent 3 cycles of FastPrep 24TM-5 (MP Biomedicals, Strasbourg, France) before being heated at 56°C for 2 hours ...
-
No products found
because this supplier's products are not listed.
Suha Naffar-Abu Amara, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 3 and 5 and counted using a particle counter (Z1; Beckman Coulter, Inc.). Experiments were carried out in triplicate ...
-
No products found
because this supplier's products are not listed.
J. Christopher Rounds, et al.,
bioRxiv - Neuroscience 2021
Quote:
... sonicated for 3×5 minutes in a 4°C Bioruptor ultrasonicator (UCD-200, Diagenode), vortexed ...
-
No products found
because this supplier's products are not listed.
Caroline S. Simon, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3-5% parasitemia) were purified using magnetic activated cell sorting (VarioMACS™ Separator, Miltenyi Biotec). Importantly ...
-
No products found
because this supplier's products are not listed.
Peter Kilfeather, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5% CO2 and then imaged on a FlexStation 3 Multi-Mode Microplate Reader (Molecular Devices) at 37°C ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Melody Li, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Patch pipettes of 3-5 MΩ (Harvard Apparatus) were made using a puller (P-1000 ...
-
No products found
because this supplier's products are not listed.
Kevin J. McNaught, et al.,
bioRxiv - Molecular Biology 2020
Quote:
H3K27me2/3 ChIP using anti-H3K27me2/3 antibody (Active Motif, 39536) was performed as previously described (12 ...
-
No products found
because this supplier's products are not listed.
Takushi Shimomura, et al.,
bioRxiv - Biophysics 2022
Quote:
In PI(3, 5)P2-injection experiments, 5 mM PI(3, 5)P2–diC8 (Echelon Biosciences) was manually injected by positive pressure using the glass needle filled with the PI(3 ...
-
No products found
because this supplier's products are not listed.
Zackary Sabetta, et al.,
bioRxiv - Neuroscience 2023
Quote:
A total of 64 young adult age-matched male and naturally cycling female Sprague-Dawley rats (~3 months old; males 367 ± 3 g and females 235 ± 1.5 g; n = 5-6/group; Envigo, Indianapolis, IN, USA) were used in these experiments and maintained in a 12:12 h light:dark cycle in a temperature and humidity-controlled room ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Roman Sloutsky, et al.,
bioRxiv - Biochemistry 2020
Quote:
... blotted for 5 s and plunge-frozen into liquid ethane using Cryoplunge 3 (Gatan).
-
No products found
because this supplier's products are not listed.
Robin Ganesan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 10 μl RNA from total or immunopurified ribosomes were 3’ dephosphorylated and 5’ phosphorylated as described above 30 and was selectively recovered with RNA Clean and Concentrator-5 (Zymo) according to the manufacturer’s instructions ...
-
3-chloro-5-hydroxybenzoic Acid is a selective agonist of the lactate receptor GPR81.
Cat# S5400, SKU# S5400-25mg,
25mg, $97.00
Ask
Vivek K. Bajpai, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3 μM CHIR99021(Selleck Chemicals) was added ...
-
No products found
because this supplier's products are not listed.
Hideki Nakamura, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Arp2/3 complex (Cytoskeleton, Inc. RP01P), and GST-WASP-VCA (Cytoskeleton ...
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
Karen Gu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... This cDNA library was then PCR barcoded with PCR Primer 1.0 (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG-3’) and a sample-specific barcode primer (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTG-3’) using MyTaq Red Mix (Bioline) for 15 cycles ...
-
No products found
because this supplier's products are not listed.
Danielle R. Adney, et al.,
bioRxiv - Microbiology 2022
Quote:
... fluorescent probe (5’-6FAM-TTGACAGGCAAACAGCACAAGCAG-BHQ1-3’) (Biosearch Technologies, Novato, CA, USA). The QPCR reactions were carried out at 50 °C for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Timm O. Koller, et al.,
bioRxiv - Biochemistry 2022
Quote:
Grids (Quantifoil R3/3 Cu300 with 3 nm holey carbon) were glow discharged and 4 µL of sample (8 OD260/mL ...
-
No products found
because this supplier's products are not listed.
Hiroshi Ichise, et al.,
bioRxiv - Immunology 2021
Quote:
... BA685RIF‐3 (Olympus), two dichroic mirrors ...
-
No products found
because this supplier's products are not listed.
Aathira Gopinath, et al.,
bioRxiv - Biophysics 2023
Quote:
... 1-oxyl2,2,5,5-tetramethyl-3-pyrroline-3-methyl methanethiosulfonate (MTSL, Toronto Research Chemicals) and kept stirring at room temperature for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Thorsten M. Leucker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
No products found
because this supplier's products are not listed.
Shanna H. Coop, Jacob L. Yates, Jude F Mitchell,
bioRxiv - Neuroscience 2022
Quote:
... We inserted tungsten 2.5- to 5-MΩ electrodes (1-3 FHC) that were mounted onto a lightweight screw micro-drive (Crist Instrument ...
-
No products found
because this supplier's products are not listed.
Vassilis Stratoulias, et al.,
bioRxiv - Neuroscience 2021
Quote:
... further washed 3×5 min in PBS and mounted in Fluoromount-G (SouthernBiotech, 0100-01). Images were acquired with a Zeiss LSM700 confocal laser scanning microscope and assembly was performed with ImageJ/Fiji ...
-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Luke A Johnson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... In all patients a directional “1-3-3-1” electrode was used (4/5 patients: Abbott Infinity model 6172 ...
-
No products found
because this supplier's products are not listed.
Saphala Dhital, Naren R. Vyavahare,
bioRxiv - Bioengineering 2019
Quote:
DiR (1, 1-dioctadecyl-3, 3, 3, 3-tetramethylindotricarbocyanine iodide) (PromoCell GmbH, Heidelberg, Germany) loaded BSA (Seracare ...
-
No products found
because this supplier's products are not listed.
Juan Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sulfo-Cyanine 3 Azide (2-5 uM final, Lumiprobe, #D1330), and fresh Sodium Ascorbate (100 mM final ...
-
No products found
because this supplier's products are not listed.
Ling Bai, et al.,
bioRxiv - Physiology 2021
Quote:
... Exendin-3 (ApexBio, B6943) 10 ug/mouse in saline.
-
No products found
because this supplier's products are not listed.
Valerie Y. Odeh-Couvertier, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 μL of 100/3 mM DSS-D6 in deuterium oxide (Cambridge Isotope Laboratories) were added to 1.7 mm NMR tubes (Bruker BioSpin) ...
-
No products found
because this supplier's products are not listed.
Ankit Tanwar, Pamela Stanley,
bioRxiv - Immunology 2022
Quote:
... ∼3-5×107 thymocytes were incubated with 20 μg anti-CD4 (rat IgG2b clone GK1.5, BioXCell) and 37.5 μg anti-CD8a (rat IgG2a clone 53-6.72 ...
-
No products found
because this supplier's products are not listed.
Silvana Valtcheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Nanoject III (Drummond Scientific, Item# 3-000-207) was used for AuCx ...
-
No products found
because this supplier's products are not listed.
Y. Shi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 0.5mM adenosine 3’,5’-cyclic monophosphate (cAMP, Enzo Life Science), 2ng/ml transforming growth factor beta 3 (TGFβ3 ...
-
No products found
because this supplier's products are not listed.
Ligia B. Schmitd, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mice were anesthetized with isoflurane (5% induction, 2-3% maintenance, SomnoSuite Kent Scientific) 10d after the first SNC and the crush placed immediately proximal to the first one ...
-
No products found
because this supplier's products are not listed.
Nicholas C. Bauer, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3-5×104 cells were seeded into each well of a chambered 8-well 1.5H coverglass (Ibidi 80827) and allowed to adhere overnight prior to further manipulation ...
-
No products found
because this supplier's products are not listed.
Daisuke Oikawa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and OTUD1 (NBP1-90484, Novus Biologicals; 3 μg) were used.