-
No products found
because this supplier's products are not listed.
Carly R. Mickelson, et al.,
bioRxiv - Neuroscience 2022
Quote:
... we delivered the Iκ-kinase inhibitor [5-(p-Fluorophenyl)-2-ureido]thiophene-3-carboxamide (TPCA-1; Sigma-Aldrich CAS 507475-17-4 ...
-
No products found
because this supplier's products are not listed.
Dominique Massey-Harroche, et al.,
bioRxiv - Cell Biology 2023
Quote:
... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
No products found
because this supplier's products are not listed.
Christopher Douglas, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Peter H. Culviner, et al.,
bioRxiv - Microbiology 2020
Quote:
... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Huan Du, et al.,
bioRxiv - Neuroscience 2021
Quote:
... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
No products found
because this supplier's products are not listed.
Jamil Mahmud, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5’-CGCCTTCGTTACAAGCATCG-3’; antisense, 5’-AAGAGCAAACGCATCTCCGA-3’), GAPDH (sense, 5’-ACCCACTCCTCCACCTTTGAC-3’; antisense, 5’-CTGTTGCTGTAGCCAAATTCGT-3’) using Green GoTaq master mix (Promega, Madison, WI) with C1000 Touch Thermal Cycler (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Serena Notartomaso, et al.,
bioRxiv - Neuroscience 2024
Quote:
... VU0360172 [N-cyclobutyl-6-(2-(3-fluorophenyl)ethynyl) pyridine-3-carboxamide] was purchased from Tocris Bioscience (Bristol ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Laura Miguel-Romero, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
No products found
because this supplier's products are not listed.
Anna-Leigh Brown, et al.,
bioRxiv - Neuroscience 2021
Quote:
RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Jana Hucklenbroich, et al.,
bioRxiv - Plant Biology 2021
Quote:
... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Kathleen E. McGrath, et al.,
bioRxiv - Cell Biology 2024
Quote:
... IL-3 (5 ng/ml, Peprotech), and cholesterol-rich lipids (40 mg/mL ...
-
No products found
because this supplier's products are not listed.
Patricia Bilodeau, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5’-ATAAGCTCCCTGCCCGAGTC-3’ (Santa Cruz sc-430739).
-
No products found
because this supplier's products are not listed.
J. Aaron Crapster, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
No products found
because this supplier's products are not listed.
Janine Hochmair, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 14-3-3 (#ab51129, Abcam), and α-tubulin (#T6074 ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 3’-deoxyadenosine-5’-triphosphate (3’-dATP, Jena Bioscience) at 2 mM and MgCl2 at 4 mM was incubated for 15 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Zhilei Zhao, David Tian, Carolyn S. McBride,
bioRxiv - Neuroscience 2020
Quote:
[2] GAL4d from pBPGAL4.1Uw (Addgene plasmid #26226)(Primers:ADdomain,forward,5’-caggcggccgccataTGCATGGATCCGCCAACTTC AACCAGAGTGG-3’, reverse, 5’-tatcgatagacgtca CTACTCCTTCTTTGGGTTCGG-3’; BD domain ...
-
No products found
because this supplier's products are not listed.
Valentina Fajner, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... CG42797EcoRI_F: 5’-CCGgaattcATGGAGCCACCAGCT-3’ and CG42797XhoI_R: 5’-TAGAGGTACCctcgagCTACTCAATGCCGAACGTGTTG-3’ and cloned by enzymatic digestion into a pGEX6P1(GE Healthcare).
-
No products found
because this supplier's products are not listed.
Neil Fleck, Christoph Grundner,
bioRxiv - Genetics 2021
Quote:
... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
No products found
because this supplier's products are not listed.
Caitlyn B. Smith, et al.,
bioRxiv - Microbiology 2024
Quote:
... zonula occludens-3 (ZO-3) (Cell Signaling Technologies), anti-mouse IgG (Alexa Fluor® 488 ...
-
No products found
because this supplier's products are not listed.
Siyi Huang, et al.,
bioRxiv - Immunology 2019
Quote:
... cyanine 3 and cyanine 5 (Perkin Elmer). The ACD 3-plex negative control probe was run in parallel on separate sections in each experiment to assess the background level and set the acquisition parameter ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Goki Tsujimoto, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 3-Mercaptopicolinic Acid (5 mM; Cayman chemical, 20895).
-
No products found
because this supplier's products are not listed.
Hridesh Banerjee, et al.,
bioRxiv - Immunology 2020
Quote:
... Tim-3 clone RMT 3-23 (BioLegend) and clone FAB1529 (R&D) ...
-
No products found
because this supplier's products are not listed.
Rutger D. Luteijn, et al.,
bioRxiv - Immunology 2022
Quote:
... 3′3′-cyclic-di-AMP (3′3′ CDA) (Invivogen, cat. no. tlrl-nacda), 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA ...
-
No products found
because this supplier's products are not listed.
Jason A Iskarpatyoti, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5 ng/mL recombinant murine IL-3 (R&D Systems, and 5% stem cell factor-containing supernatant from CHO-KL cells for 4-6 weeks until maturation ...
-
No products found
because this supplier's products are not listed.
Anna L. Vlasits, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Boroscillate pipettes (Sutter Instruments, 3-5 MΩ) were used for all recordings and whole-cell electrophysiology recordings were performed using a Multiclamp 700B amplifier (Molecular devices) ...
-
No products found
because this supplier's products are not listed.
Senthil T. Kumar, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5 mg of 1,2-fioleoyl-sn-glycero-3-phosphoethanolamine (DOPE):1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS):1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) 5:3:2 w/w (Avanti Polar Lipids) were resuspended in 0.8 mL methanol:chloroform 1:1 ...
-
No products found
because this supplier's products are not listed.
Bailey A. Wallace, et al.,
bioRxiv - Genomics 2024
Quote:
... and vortexed at speed 3 (∼600rpm) for 5 minutes (VWR Analog Vortex Mixer ...
-
No products found
because this supplier's products are not listed.
Dairui Li, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Cells were passaged every 3–5 days with ReLeSR (STEMCELL Technologies). All cells used had a normal diploid karyotype.
-
No products found
because this supplier's products are not listed.
Nioosha Nekooie-Marnany, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cy-3 or Cy-5 (Jackson Immunoresearch Laboratories), and processed for DAPI or Hoechst staining to visualize cells’ nuclei before mounting in ImmuMount medium (Shandon) ...
-
No products found
because this supplier's products are not listed.
Aniruddha Das, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A 3×5 mm2 craniotomy was drilled (Omnidrill35, World Precision Instruments) over an area covering the monocular and binocular primary visual (V1m and V1b ...
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Zhijie Chen, et al.,
bioRxiv - Biophysics 2019
Quote:
... transcription was chased by adding 40 µM NTPs mix together with 50 µM of each type of 3’-deoxynucleotide RNA chain terminators (3’dATP, 3’dCTP, 3’dGTP, 3’dUTP, TriLink Biotechnologies). The reactions were allowed to proceed at room temperature for 10 min before terminated by adding the 2× urea stop buffer ...
-
No products found
because this supplier's products are not listed.
Jennifer S. Chen, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 3 dpi by high content imaging (BioTek Cytation 5) configured with brightfield and GFP cubes ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004185,
Bulk, Inquire
Ask
Faten A. Sayed, et al.,
bioRxiv - Neuroscience 2020
Quote:
... incubated with 3% collagenase type 3 (Worthington), 3 U/ml dispase (Worthington ...
-
No products found
because this supplier's products are not listed.
Robert M. Cooper, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 3 μM GSK-3 inhibitor (XVI, Calbiochem; 361559) for the first 3 days.
-
No products found
because this supplier's products are not listed.
R. I. Kushak, et al.,
bioRxiv - Pathology 2019
Quote:
... Sections were washed with PBS/5% goat serum 3 times for 3 minutes each and fixed with Aqua-Mount (Polysciences, Warrington, PA). Control kidney sections lacked primary antibodies.
-
No products found
because this supplier's products are not listed.
Clémentine Villeneuve, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 5% CO2 on a 3 μm pore size cell culture insert (Corning) in DMEM supplemented with Glutamax ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
Cat# HY-111640-10 mM * 1 mL,
10 mM * 1 mL, USD $165.0
Ask
Shuangshuo Jia, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and the autophagy inhibitor 3-methyladenine (3-MA; 5 mM; MedChemExpress) were applied to validate their respective effects.
-
No products found
because this supplier's products are not listed.
Sangeeta Goswami, et al.,
bioRxiv - Immunology 2022
Quote:
... 3′-3-diaminobenzidine (DAB) substrate (Leica Microsystems) was used as a chromogen followed by hematoxylin counterstain ...
-
No products found
because this supplier's products are not listed.
Chen Qian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The UGT2B15 promoter 20 base-pair sequence (5’-TAACTTGATTGATTTTTCCT-3’ for wild type and 5’-TAACTTGGCTGTCTTTTCCT-3’ for mutant) was immobilized to a streptavidin SADH sensor chip (Sartorius) in running buffer (10 mM HEPES pH 6.8 ...
-
No products found
because this supplier's products are not listed.
Kamal Mandal, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 5 mg of C18 solid phase (3 μm, Durashell, Phenomenex). The HpHt column was sequentially washed with a series of 3 different solvents/solutions namely methanol ...
-
No products found
because this supplier's products are not listed.
Áron Kőszeghy, et al.,
bioRxiv - Neuroscience 2023
Quote:
3-5 months old male C57/BL6J mice (Charles River, UK) were anesthetized with isoflurane (4% induction ...
-
No products found
because this supplier's products are not listed.
Jia-Shuo Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... fluo-3 acetoxymethyl (Fluo-3 thereafter) ester (Biotium, US) following a protocol adapted from (Zhang et al. ...
-
No products found
because this supplier's products are not listed.
Truc Do, et al.,
bioRxiv - Microbiology 2019
Quote:
... 0.6% 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Anatrace), 0.5% Triton X-100 reduced ...