-
No products found
because this supplier's products are not listed.
Rukesh Chinthapatla, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Cytidine 5’-O-(1-thiotriphosphate) and 3’-deoxycytidine 5’-triphosphate were from TriLink. Adenosine 5’-O-(1-thiotriphosphate ...
-
No products found
because this supplier's products are not listed.
Bianca Castro Gouveia-Mageste, et al.,
bioRxiv - Plant Biology 2020
Quote:
... amino acids 98-106 (Miltenyi Biotec, 130-091-972; 1:10.000) or anti-GFP (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
Ben E. Clifton, et al.,
bioRxiv - Biochemistry 2021
Quote:
... N1-methylguanosine (>98%, NM08574; Carbosynth).
-
No products found
because this supplier's products are not listed.
Yesica R Frontini-Lopez, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5 mM MgCl2 reaction buffer containing 0.015% w/v 5-bromo-4-chloro-3-indolyl phosphate-BCIP-(Calbiochem) substrate and 0.03% w/v nitro blue tetrazolium-NBT-(BDH Chemicals Ltd. ...
-
No products found
because this supplier's products are not listed.
Chen Sun, Kai-Chun Chang, Adam R. Abate,
bioRxiv - Genomics 2020
Quote:
... Two syringes backfilled with HFE-7500 fluorinated oil (3M, catalog no. 98-0212-2928-5) were loaded with (1 ...
-
No products found
because this supplier's products are not listed.
Aaron Yip, et al.,
bioRxiv - Bioengineering 2024
Quote:
... The purified protein from elutions containing the fewest contaminating proteins (typically elution steps 3-5) were concentrated in 1× PBS using a 5 kDa cut-off Vivaspin Centrifugal Concentrator (Sartorius, Oakville, Ontario, Canada). Protein concentrations were determined using the micro-BCA assay (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Aniruddha Das, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A 3×5 mm2 craniotomy was drilled (Omnidrill35, World Precision Instruments) over an area covering the monocular and binocular primary visual (V1m and V1b ...
-
No products found
because this supplier's products are not listed.
Allison K. Meyers, et al.,
bioRxiv - Immunology 2021
Quote:
... LC-3 (Novus Biologicals, no. NB100-2220; 1:500), P62 (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Emmanuelle Grall, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Signal amplification was done with 1:50 TSA Plus Cyanine-3 or -5 (Akoya Biosciences) for 1 h at RT ...
-
No products found
because this supplier's products are not listed.
Annelot C. M. van Esbroeck, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... After rinsing the membrane with TBS-T (3 × 5 min) and TBS (3 × 5 min) fluorescence was detected by scanning on the Odyssey CLx (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
X. Rosa Ma, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
No products found
because this supplier's products are not listed.
Jennifer S. Chen, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 3 dpi by high content imaging (BioTek Cytation 5) configured with brightfield and GFP cubes ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
Prepared to contain higher collagenase and caseinase activities. A dialyzed, lyophilized powder.
Cat# LS005282,
1 gm, $246.00
Ask
Yina Wang, et al.,
bioRxiv - Microbiology 2022
Quote:
... lung tissue was minced in 5 ml of 1 x PBS containing 3 mg/ml collagenase type IV (Worthington). Samples were incubated at 37°C for 45 min and washed with 1 x PBS three times ...
-
No products found
because this supplier's products are not listed.
Raquel Martinez-Curiel, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Biocytin (1-3 mg/mL, Biotium) was dissolved in the pipette solution for post-hoc identification of recorded cells.
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
N Hammoudi, et al.,
bioRxiv - Microbiology 2020
Quote:
... Tube underwent 3 cycles of FastPrep 24TM-5 (MP Biomedicals, Strasbourg, France) before being heated at 56°C for 2 hours ...
-
No products found
because this supplier's products are not listed.
Chuanhai Zhang, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... ALLICIN (98%, YZ-100384, Solarbio) purchased from Solarbio Life Science Biotechnology Co ...
-
No products found
because this supplier's products are not listed.
Shanna H. Coop, Jacob L. Yates, Jude F Mitchell,
bioRxiv - Neuroscience 2022
Quote:
... We inserted tungsten 2.5- to 5-MΩ electrodes (1-3 FHC) that were mounted onto a lightweight screw micro-drive (Crist Instrument ...
-
No products found
because this supplier's products are not listed.
Carl Schulz, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... to 2/98% over 2:50 min:sec on a Luna™ 5 µm C18 50x2.0 mm 100 A column (Phenomenex, Aschaffenburg, Germany). For MS/MS analyses in the positive electrospray ionisation mode on a Varian 1200 TSQ (Agilent Technologies ...
-
No products found
because this supplier's products are not listed.
SS Parker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and 1.0% (wt/vol) DNase (Bioline, 9003-98-9) in calcium- and magnesium-free 1X HBSS (Gibco ...
-
No products found
because this supplier's products are not listed.
Mirushe H. Miftari, Bernt T. Walther,
bioRxiv - Developmental Biology 2022
Quote:
... embryos were paraffin-embedded and serially sectioned at 3-5 µm (Leica microtome), before attachment to poly-L-lysine-coated glass slides (Sigma ...
-
No products found
because this supplier's products are not listed.
Luke A Johnson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... In all patients a directional “1-3-3-1” electrode was used (4/5 patients: Abbott Infinity model 6172 ...
-
No products found
because this supplier's products are not listed.
David S Uygun, et al.,
bioRxiv - Neuroscience 2021
Quote:
... sIPSCs were recorded at −70 mV in the presence of the glutamate receptor antagonists (20 μM 6-cyano-7-nitroquinoxaline-2,3-dione +50 μM D-(2R)-amino-5-phosphonopentanoic acid) using a Multiclamp 700B amplifier and pClamp 10.0 software (Molecular devices; California, United States). A 1 min period after 5 min application of the glutamate receptor antagonists was used for statistical analysis (Igor software ...
-
No products found
because this supplier's products are not listed.
Emilia Neuwirt, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 - 5 μM MCC950 (Adipogen), 50 - 200 nM MG132 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Yohan S.S. Auguste, et al.,
bioRxiv - Neuroscience 2022
Quote:
... subcutaneous] before being anesthetized using isoflurane (SomnoSuite, Kent Scientific; 3-5% induction, 1-2% maintenance). Once anesthetic depth was achieved ...
-
No products found
because this supplier's products are not listed.
Melody Li, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Patch pipettes of 3-5 MΩ (Harvard Apparatus) were made using a puller (P-1000 ...
-
No products found
because this supplier's products are not listed.
Y. Shi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 0.5mM adenosine 3’,5’-cyclic monophosphate (cAMP, Enzo Life Science), 2ng/ml transforming growth factor beta 3 (TGFβ3 ...
-
No products found
because this supplier's products are not listed.
Rebecca J. Harris, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 2 μl of precleared chromatin was added to 98 μl buffer iE1 (Diagenode). To samples and inputs ...
-
No products found
because this supplier's products are not listed.
Kevin W. Graepel, et al.,
bioRxiv - Microbiology 2019
Quote:
... genomic RNA was detected with a 5’ 6-carboxyfluorescein (FAM) and 3’ black hole quencher 1 (BHQ-1) labeled probe targeting nsp2 (Biosearch Technologies, Petaluma, CA), and RNA copy number was calculated by reference to an RNA standard derived from the MHV A fragment ...
-
No products found
because this supplier's products are not listed.
PW Frazel, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3 µM CHIR99201 (Biovision 1991-1), and 1 µM PD0325901 (Sigma PZ0162-5MG ...
-
No products found
because this supplier's products are not listed.
Breygina Maria, et al.,
bioRxiv - Plant Biology 2020
Quote:
MP of pollen protoplasts was assessed by staining with 1 µM DiBAC4(3) for 5 min (Breygina et al. 2010) on Gallios flow cytometer (Beckman Coulter), analysis was performed with FlowJo software (TreeStar) ...
-
No products found
because this supplier's products are not listed.
Lihong Wang-Bishop, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Mice in groups receiving αPD-1 and αCTLA-4 (100 µg, every 3 days for 5 injections, BioXcell, West Lebanon NH) were treated intraperitoneally ...
-
No products found
because this supplier's products are not listed.
Nicholas A. Pudlo, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 mice were switched to a diet containing 3% Porphyrayezoensis (TD.190608, Envigo), which was ground into a course powder and added to TD.190608 to replace 3% of the dextrose contained in the base diet ...
-
No products found
because this supplier's products are not listed.
Robin Ganesan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 10 μl RNA from total or immunopurified ribosomes were 3’ dephosphorylated and 5’ phosphorylated as described above 30 and was selectively recovered with RNA Clean and Concentrator-5 (Zymo) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yan Li, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Unc13-3 (1:1000, Synaptic systems, 126303), Synpo1 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Lei Chen, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... ATPase (MBL International Corp. D032-3, 1:200), P63 (Santa Cruz sc-8343 ...
-
No products found
because this supplier's products are not listed.
Haidai Hu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Freshly purified ZorAB sample was concentrated to 2-3 mg/mL and 2.7 μL protein was applied onto the glow-discharged (30 s, 5 mA) grids (Quantifoil R0.6/1 300 mesh Au) and plunge-frozen into liquid ethane using a Vitrobot Mark IV (FEI ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Takushi Shimomura, et al.,
bioRxiv - Biophysics 2022
Quote:
In PI(3, 5)P2-injection experiments, 5 mM PI(3, 5)P2–diC8 (Echelon Biosciences) was manually injected by positive pressure using the glass needle filled with the PI(3 ...
-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Guillaume Jacquemin, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Organoids were then washed with PBS for 3 times for 5 min each and stored in 1:1 ratio PBS and glycerol (Euromedex 15710) before imaging ...
-
No products found
because this supplier's products are not listed.
Juan Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sulfo-Cyanine 3 Azide (2-5 uM final, Lumiprobe, #D1330), and fresh Sodium Ascorbate (100 mM final ...
-
5a-Pregnane-3,20-dione (5alphaP, 5-a-dihydroprogesterone, 3,20-allopregnanedione,...
Cat# S3206, SKU# S3206-100mg,
100mg, $107.00
Ask
Alexandra Nguyen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Z-VAD-FMK and the HSP70 inhibitor JG-98 were from Selleck Chemicals, Munich ...
-
No products found
because this supplier's products are not listed.
Andrew B. Stergachis, et al.,
bioRxiv - Genetics 2023
Quote:
... which preserves 3’ and 5’ end information (PacBio, Menlo Park, CA). A PacBio SMRTbell library was constructed using these PCR-amplified full-length cDNA transcripts and sequenced using a Sequel II ...
-
No products found
because this supplier's products are not listed.
Max D. Knickmeyer, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Embryos were examined at 3-5 dpf using a stereomicroscope (Nikon SMZ18) with a light source for fluorescence ...
-
No products found
because this supplier's products are not listed.
Benjamin N. Bell, et al.,
bioRxiv - Immunology 2021
Quote:
RBD antigen binding during selection rounds 3 and 5 was evaluated using a 1:1000 dilution of rabbit anti-His FITC secondary antibody (Bethyl Laboratories). RBD antigen binding during selection Round 4 was evaluated using a 1:1000 dilution of Streptavidin-Alexa Fluor 647 secondary (Jackson ImmunoResearch) ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Haydee L. Gutierrez, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... Slides were then washed in PBS + 0.1% Triton 3 × 10 min and PBS 1 × 5 min then coverslipped with Fluoromount G (Southern biotech Cat OB10001) under glass cover slips ...
-
No products found
because this supplier's products are not listed.
Fenghua Zhang, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Fluorescent donor embryos and PGCs-depleted host embryos at 3 hour-post-fertilization (3 hpf) were manipulated in 1×Danieau’s buffer under a dissecting microscope (MZX7, Olympus). Briefly ...