-
No products found
because this supplier's products are not listed.
Cheng Wu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3-dione (CNQX) (Sigma, C127, USA), GABA (Sigma ...
-
No products found
because this supplier's products are not listed.
Beerend H.J. Winkelman, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 3-dione (CNQX, Tocris) or DNQX (Tocris) ...
-
No products found
because this supplier's products are not listed.
Sasimonthakan Tanarsuwongkul, et al.,
bioRxiv - Plant Biology 2022
Quote:
The stock solutions for the GLVs (Z)-3-hexen-1-ol (Z3-HOL, 98%; Acros Organics) and (Z)-3-hexenyl acetate (Z3-HAC ...
-
No products found
because this supplier's products are not listed.
Fangmin Zhou, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Sébastien Campagne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and 60 mg/L of alpha-ketoisovaleric acid (13C5, 98%; 3-D1, 98%, Cambridge Isotope Laboratory). All the recombinant protein expressions were performed at 37°C during 4 hours in presence of 1 mM IPTG.
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
No products found
because this supplier's products are not listed.
Lauren Rice, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 5% (v/v) (3-Aminopropyl) triethoxysilane (APTES) (98%, Alfa Aesar, USA) was added to coverslips in Milli-Q water and incubated for 15 min ...
-
No products found
because this supplier's products are not listed.
Benjamin C. Shaw, et al.,
bioRxiv - Molecular Biology 2022
Quote:
The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
No products found
because this supplier's products are not listed.
Hannah Elcocks, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
No products found
because this supplier's products are not listed.
Jorge Garcia Morato, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Ex 527 (CAS 49843-98-3, Santa Cruz Biotechnology) was dissolved in DMSO and added to the cultured cells 24 hours before lysis to a final concentration of 1 or 10μM.
-
No products found
because this supplier's products are not listed.
Atossa C. Ghorashi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 1-Methyl-3-Isobutylxanthine (IBMX, ≥ 98% pure) was purchased from Cayman Chemicals (catalog no. 13347); stock concentrations were made at 50 mM in DMSO ...
-
No products found
because this supplier's products are not listed.
Jonathan P. Hannan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... GDP (Abcam; (>98 %)) ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Jamil Mahmud, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5’-CGCCTTCGTTACAAGCATCG-3’; antisense, 5’-AAGAGCAAACGCATCTCCGA-3’), GAPDH (sense, 5’-ACCCACTCCTCCACCTTTGAC-3’; antisense, 5’-CTGTTGCTGTAGCCAAATTCGT-3’) using Green GoTaq master mix (Promega, Madison, WI) with C1000 Touch Thermal Cycler (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Yaman Musdal, et al.,
bioRxiv - Biochemistry 2023
Quote:
The steroids 5-androsten-3,17-dione and 4-androsten-3,17-dione were purchased from Steraloids Inc ...
-
No products found
because this supplier's products are not listed.
Hannah M. Starnes, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Perfluorohexanoic acid (PFHxA, CAS 307-24-2, purity ≥ 98%) and PFBS (CAS 375-73-5, purity ≥ 98%) were from TCI America (Portland ...
-
No products found
because this supplier's products are not listed.
Hejian Xiong, et al.,
bioRxiv - Neuroscience 2021
Quote:
1,2-Dipalmitoyl-sn-glycero-3-phosphocholine (DPPC, 63-89-8, >99%) and cholesterol (ovine wool, 57-88-5, >98%) were purchased from Avanti Polar Lipids, Inc ...
-
No products found
because this supplier's products are not listed.
Jana Hucklenbroich, et al.,
bioRxiv - Plant Biology 2021
Quote:
... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
No products found
because this supplier's products are not listed.
Emma J. van Bodegraven, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... An overnight blunt ligation was induced for the 5’ of exon 1 and the 3’ of exon 3 (5 U T4 DNA ligase (Roche, Basel, Switzerland)) at room temperature ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Adam E. Handel, et al.,
bioRxiv - Immunology 2021
Quote:
... (28+98) (Illumina). For the Tbx1LacZ/+Crkl+/- dataset ...
-
No products found
because this supplier's products are not listed.
Austin J. Graham, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... sodium fumarate (Na2C4H2O4, VWR, 98%), HEPES buffer solution (C8H18N2O4S ...
-
No products found
because this supplier's products are not listed.
Birte Blunk, et al.,
bioRxiv - Microbiology 2020
Quote:
... N-(3-Aminopropyl) methacrylamide hydrochloride (APMA, >98%) was obtained from Polysciences Inc ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Kathleen E. McGrath, et al.,
bioRxiv - Cell Biology 2024
Quote:
... IL-3 (5 ng/ml, Peprotech), and cholesterol-rich lipids (40 mg/mL ...
-
No products found
because this supplier's products are not listed.
Zhilei Zhao, David Tian, Carolyn S. McBride,
bioRxiv - Neuroscience 2020
Quote:
[2] GAL4d from pBPGAL4.1Uw (Addgene plasmid #26226)(Primers:ADdomain,forward,5’-caggcggccgccataTGCATGGATCCGCCAACTTC AACCAGAGTGG-3’, reverse, 5’-tatcgatagacgtca CTACTCCTTCTTTGGGTTCGG-3’; BD domain ...
-
No products found
because this supplier's products are not listed.
Elaine Thai, et al.,
bioRxiv - Immunology 2020
Quote:
Purified 5D5 Fab and CSP 81-98 peptide (GenScript) were mixed in a 1:5 molar ratio ...
-
No products found
because this supplier's products are not listed.
Renée M. van der Sluis, et al.,
bioRxiv - Immunology 2021
Quote:
... r-a-hTRIF (98 kDa, Cell Signaling Technology, cat#4596) was used ...
-
No products found
because this supplier's products are not listed.
Nicholas A. W. Bell, et al.,
bioRxiv - Biophysics 2020
Quote:
... of λ-DNA using the following primers: 5’-CGAACTCTTCAAATTCTTCTTCCA-3’ and 5’-GATTGCTCTTCTGTAAGGTTTTG-3’ with a 5:1 ratio of dTTP:biotin-11-dUTP (Jena Bioscience). Similarly ...
-
No products found
because this supplier's products are not listed.
Hua Li, et al.,
bioRxiv - Cell Biology 2020
Quote:
... was amplified by PCR using the primers (5’-GGTTCCGCGTGGATCCATGTCTCATGCAGCCGAGCCA-3’ and 5’-GGAATTCCGGGGATCCTCAGGACTCCTCTTCAATGCTGA-3’) and cloned into BamHI site of pGEX-4T-1 expression vector (GE Healthcare) using In-Fusion HD Cloning System (Clontech) ...
-
No products found
because this supplier's products are not listed.
Alexandra Grubman, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Paraffin embedded human brain sections were de-waxed for antigen retrieval with 90% formic acid (5 min) followed by citrate boiling (45min, 98°C DAKO Citrate Buffer, DAKO PT Link). Sections were then blocked using 0.1% (w/v ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Delf Kah, et al.,
bioRxiv - Biophysics 2024
Quote:
... 98 µl of 10.2 mg/ml Matrigel (Corning), 37.1 µl NaHCO3 ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
Umit Akkose, et al.,
bioRxiv - Genomics 2020
Quote:
... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
B Le Gac, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 6,7-dinitroquinoxaline-2,3-dione (DNQX, 10µM, Hellobio, HB0262), LY367385 (100µM ...
-
No products found
because this supplier's products are not listed.
Brecht Creyns, et al.,
bioRxiv - Immunology 2023
Quote:
... and DNaseI (9003-98-9, STEMCELL Technologies) for 40 min at 37°C in complete HBSS (21-023-CV ...
-
No products found
because this supplier's products are not listed.
Cassandra L. Kooiker, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Sections were washed in PBST (3 × 5 min.) and then incubated in 1% ABC solution (Vectastain, Vector Laboratories, Burlingame, CA) and washed again in PBST (3 × 5 min.) ...
-
No products found
because this supplier's products are not listed.
Rebekah Honce, et al.,
bioRxiv - Microbiology 2021
Quote:
... and oseltamivir carboxylate (Toronto Research Chemicals, Lot 3-SKC-52-1, Purity 98%) with a qualified LC MS/MS assay ...
-
No products found
because this supplier's products are not listed.
Stefanos Zafeiropoulos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... PH was induced in 98 male Sprague-Dawley rats (5-7 weeks, 150-200g, Charles River) using either the Sugen-Hypoxia-Normoxia (SuHxNx ...
-
No products found
because this supplier's products are not listed.
Eduardo Pulgar, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Glass capillaries (BF100-98-15, Sutter Instruments) were pulled using a needle puller (P-97 ...
-
No products found
because this supplier's products are not listed.
Jason A Iskarpatyoti, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5 ng/mL recombinant murine IL-3 (R&D Systems, and 5% stem cell factor-containing supernatant from CHO-KL cells for 4-6 weeks until maturation ...
-
Cat# HY-W018758-1 mg,
1 mg, USD $120.0
Ask
Stefanie K. Menzies, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... prinomastat hydrochloride (Cat no: HY-12170A, >98%, MedChemExpress). Varespladib (2-[[3-(2-Amino-2-oxoacetyl)-2-ethyl-1-(phenylmethyl)-1H-indol-4-yl]oxy]-acetic acid ...
-
No products found
because this supplier's products are not listed.
Asya Smirnov, et al.,
bioRxiv - Microbiology 2022
Quote:
... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
No products found
because this supplier's products are not listed.
Khanh D. Q. Nguyen, et al.,
bioRxiv - Biophysics 2020
Quote:
... 1% (w/v) 3-[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS; Anatrace; #C216), and 0.2% (w/v ...
-
No products found
because this supplier's products are not listed.
Ruilian Li, et al.,
bioRxiv - Microbiology 2021
Quote:
... After that, Samples were infiltrated in graded mixtures (1:3, 1:1, 3:1) of resin (EMS, Resin Mixture ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)