-
No products found
because this supplier's products are not listed.
Sarah Hofmann, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5 ug/ml insulin (PromoCell), 0.5 ug/ml Hydrocortisone ...
-
No products found
because this supplier's products are not listed.
Matteo Lunghi, et al.,
bioRxiv - Microbiology 2021
Quote:
... 5% dialyzed FBS (Pan Biotech P30-2102 ...
-
No products found
because this supplier's products are not listed.
Rebecca Keener, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Haploids were streaked on minimal media containing 5-Fluoroorotic Acid (5-FOA) (Toronto Research Chemicals F595000) to select against the pCAS026 plasmid followed by five passages on YPD plates before telomere elongation was observed by Southern blot (data not shown).
-
No products found
because this supplier's products are not listed.
Bangmin Liu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the pTr1 cells (5×105 cells/5 ml/flask) were seeded in T25 flasks (83.3910.002; Sarstedt) in CM ...
-
No products found
because this supplier's products are not listed.
Margs S. Brennan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... p19/ARF (clone 5.C3.1, Rockland) and HSP70 (clone N6 ...
-
No products found
because this supplier's products are not listed.
Bingyi Li, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and Cal590 (5 μM, AAT Bioquest) were used for the indication of mitochondria ...
-
No products found
because this supplier's products are not listed.
Christine E. Cucinotta, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Libraries were prepared from 5 ng of RNA using the Ovation SoLo kit (NuGEN/Tecan, custom AnyDeplete ...
-
No products found
because this supplier's products are not listed.
Anne Bourdais, Benoit Dehapiot, Guillaume Halet,
bioRxiv - Cell Biology 2021
Quote:
... then individually transferred into small (5 µl) drops of fixative (5:1:4 of methanol:acetic acid:water) on a glass-bottom dish (Mattek). After the zona pellucida had gradually dissolved ...
-
No products found
because this supplier's products are not listed.
Rene Yu-Hong Cheng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 5 µL of blocking antibody (anti-IgG, Southern Biotech) was added to the 50 µL cell solution to yield a final concentration of 25 µg/mL ...
-
Aldosterone ELISA / assay Kit
Cat# K052-H5,
1.0 ea, USD $1285.0
Ask
Diana Gataulin, et al.,
bioRxiv - Physiology 2022
Quote:
Corticosterone was measured 5 h after the dark cycle begun using the DetectX Corticosterone CLIA kit (Arbor assays). 5μl tail blood samples from mice were collected before (basal) ...
-
No products found
because this supplier's products are not listed.
Alexandra Zak, et al.,
bioRxiv - Biophysics 2019
Quote:
Silica beads (5 × 106; 5 μm diameter; Bangs Laboratories) were washed in distilled water (5,000 rpm ...
-
No products found
because this supplier's products are not listed.
Nikita Subedi, et al.,
bioRxiv - Immunology 2022
Quote:
... 5% Human Serum (HS) (Sanquin), and 25 mM HEPES (Gibco ...
-
No products found
because this supplier's products are not listed.
Haleigh N. Mulholland, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a 5 MΩ electrode (FHC) was driven approximately 7 mm down perpendicularly into the brain using a micromanipulator ...
-
No products found
because this supplier's products are not listed.
Giulio Giuliani, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5% horse serum (HS) (Euroclone ECS0090D) and 1 ng/ml TGF-beta-1 (PreproTech 100-21) ...
-
No products found
because this supplier's products are not listed.
Michael J. Hoy, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5 M Sodium Chloride (Teknova #S0251), TCEP (Soltec Ventures Inc #M115) ...
-
No products found
because this supplier's products are not listed.
Simone Caielli, et al.,
bioRxiv - Immunology 2023
Quote:
... Recombinant MxA (5 μg; Novus Biological) was then added into the lipid/TX100 solution and incubated for another 1 h with rotation ...
-
No products found
because this supplier's products are not listed.
Andrew N. Stewart, et al.,
bioRxiv - Neuroscience 2023
Quote:
Serotonin (5-HT) positive axons were identified using chromogen labeling against 5-HT (1:4000; 20080; ImmunoStar) and were either not co-labeled in the first acute experiment ...
-
No products found
because this supplier's products are not listed.
Prasath Paramasivam, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Jia Li, Haichao Zhao, Anne McMahon, Shan Yan,
bioRxiv - Molecular Biology 2022
Quote:
... Comet assays were performed using the OxiSelect Comet Assay Kit (Cell Biolabs Cat#STA-351-5) with alkaline (pH > 7.0 ...
-
No products found
because this supplier's products are not listed.
Marina Borschiwer, et al.,
bioRxiv - Genomics 2020
Quote:
... A300-793A (Bethyl Laboratories, 5 μl/ChIP); EP300 ...
-
No products found
because this supplier's products are not listed.
Anna L. Vlasits, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Boroscillate pipettes (Sutter Instruments, 3-5 MΩ) were used for all recordings and whole-cell electrophysiology recordings were performed using a Multiclamp 700B amplifier (Molecular devices) ...
-
No products found
because this supplier's products are not listed.
Desingu Ayyappa Raja, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... at 5% CO2 (Eppendorf® New Brunswick Galaxy170S). Media was changed every day and cells were passaged upon reaching 80% confluence ...
-
No products found
because this supplier's products are not listed.
Andrew P. Tosolini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... glass micropipettes (Drummond Scientific, 5-000-1001-X10), as previously described (Mohan et al. ...
-
No products found
because this supplier's products are not listed.
Flavia Chiuppesi, et al.,
bioRxiv - Immunology 2020
Quote:
... 5 ug of fragmented DNAs were converted to SMRTbell libraries using the SMRTbell Template Prep Kit 1.0 (PacBio). The libraries were size-selected (7-kb size cutoff ...
-
No products found
because this supplier's products are not listed.
Victoria A. Bonnell, et al.,
bioRxiv - Genomics 2023
Quote:
... Sonicate the chromatin until sufficiently sheared (130µL, 5% duty cycle, 75W peak incident power, 200 cycles per burst, 7°C, for 5 minutes using Covaris Focus-Ultrasonicator M220). The immunoprecipitation step included ...
-
No products found
because this supplier's products are not listed.
Kejia Zhang, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 5% suspension (IBA Lifesciences) and eluted with desthiobiotin ...
-
No products found
because this supplier's products are not listed.
Nathalie Tisch, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 5% normal donkey serum (Dianova), 0.3% TritonX-100 in PBS for 2h at RT ...
-
No products found
because this supplier's products are not listed.
R Arce-Molina, et al.,
bioRxiv - Cell Biology 2019
Quote:
... exposed to 5 × 106 PFU of Ad Pyronic (serotype 5, custom made by Vector Biolabs), and studied after 16-24 h ...
-
No products found
because this supplier's products are not listed.
Roman Praschberger, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 5 μg of head lysate or 5 μg of Human Normal Brain GenLysate (G-Biosciences) was subjected to standard SDS-PAGE using a NuPage 4-12% Bis-Tris gel (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Yoojin Lee, Hye Jeong Cho, Han Min Woo,
bioRxiv - Synthetic Biology 2020
Quote:
... or α-glucosidase (Bottle 5 in the Maltose assay kit; Megazyme Inc., Wicklow, Ireland) (Fig ...
-
No products found
because this supplier's products are not listed.
Subhamita Maitra, Bruno Vincent,
bioRxiv - Neuroscience 2022
Quote:
... detector system (ABI Quant studio 5) and the SYBR Green detection protocol ...
-
No products found
because this supplier's products are not listed.
VP O’Brien, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5% defibrinated horse blood (Hemostat Labs), 10 mg/ml vancomycin (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Wenyu Ding, et al.,
bioRxiv - Neuroscience 2023
Quote:
... or CCK (5 μg/kg) (BACHEM). Behavioral tests were usually performed 20-30 min after drug injection ...
-
No products found
because this supplier's products are not listed.
F. Abrar, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and heavy isotopes (4, 4, 5, 5-D4 L-lysine and 13C6 L-arginine, Cambridge Isotope Laboratories (CIL)) for the K4/R6 population ...
-
No products found
because this supplier's products are not listed.
Sean K. Ryan, et al.,
bioRxiv - Pathology 2019
Quote:
... 5 ml Betaflour (National Diagnostics LS-151) was added to each scintillation vial ...
-
No products found
because this supplier's products are not listed.
Morayma M. Temoche-Diaz, et al.,
bioRxiv - Biochemistry 2019
Quote:
... anti-TSG101 #GTX702-5 (Genetex, Irvine, CA), anti-CD63 #sc-15363 (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Hwan-Ching Tai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and a 5-µm filter (Pall, 4662). The filtrate was spun at 1,000 xg for 10 mins at 4 °C ...
-
No products found
because this supplier's products are not listed.
Wei Shi, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5 μL washed Myc magnetic beads (Chromotek) were added to the protein extracts of each sample and samples were then incubated on a rolling wheel at 4°C ...
-
No products found
because this supplier's products are not listed.
Olamide Ishola, et al.,
bioRxiv - Biochemistry 2024
Quote:
... aliquots of the apoAI-EfpA in β-DDM and in lipid were placed in 1.5 ml tubes and then mixed with 5 nm Gold Nanoparticles (5-nm Gold-Ni-NTA, Nanoprobes) (GNPs ...
-
No products found
because this supplier's products are not listed.
Shuang-yong Xu, et al.,
bioRxiv - Microbiology 2021
Quote:
... His-tagged SARS-CoV-2 Spike protein (5 μl) or His-tagged RBD protein (5 μl at 1.75 μg/μl, purchased from Sino Biological) were first diluted in 45 μl of MBP binding buffer ...
-
No products found
because this supplier's products are not listed.
Stephan Kamrad, et al.,
bioRxiv - Genetics 2019
Quote:
... column (New Objective, PF360-75-10-N-5) packed in house with 1.9 um C18 beads (Dr ...
-
No products found
because this supplier's products are not listed.
Zhi-Hong Shi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... containing 5% fetal bovine serum (Sciencell, Cat 0025), 1% penicillin/streptomycin solution (Sciencell ...
-
No products found
because this supplier's products are not listed.
Luke R. Joyce, et al.,
bioRxiv - Microbiology 2022
Quote:
... with ~5-8 2.7 mm glass beads (BioSpec). Clots were homogenized for 10-15 min horizontally on a vortex before serial dilution and plating on THB agar plates for enumeration ...
-
No products found
because this supplier's products are not listed.
Charlotte Rimbault, et al.,
bioRxiv - Neuroscience 2021
Quote:
... at an excitation wavelength of 485±5 nm and an emission wavelength of 520±5 nm using a POLARstar Omega (BMG Labtech) microplate reader ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... the multi-lead electrode pedestal was connected to an amplifier (10 Hz-5 KHz band-pass filter, 5 kHz sampling rate, Model 1700 Differential AC amplifier, A-M systems, Sequim, WA, USA). The signal was recorded and integrated using Spike2 version 9.0 software (Cambridge Electronic Design).
-
No products found
because this supplier's products are not listed.
Eric R Szelenyi, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 5 cm lane width (Stoelting). For testing ...
-
No products found
because this supplier's products are not listed.
Ricardo da Silva Antunes, et al.,
bioRxiv - Immunology 2023
Quote:
... in 5% human serum (Gemini Bio-Products) for 24 h ...
-
No products found
because this supplier's products are not listed.
Victor Yin, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5% BME buffer exchange solution (Sciex, MA, USA), using 10 kDA MWCO filters (Vivaproducts Inc. ...
-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Mohummad Aminur Rahman, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...