-
No products found
because this supplier's products are not listed.
Lucia Sedlackova, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM NR (ChromaDex), 10 μM olaparib (Cambridge Biosciences) ...
-
No products found
because this supplier's products are not listed.
Paola Moreno-Roman, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5% NGS (Capralogics GS0250), washed 3 times in PBT ...
-
No products found
because this supplier's products are not listed.
Karl Alex Hedin, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... for preventing bacterial growth and 1 g/L 5-Fluoroorotic Acid (5-FOA; Nordic BioSite) for preventing other yeast species from growing.
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Jaylissa Torres Robles, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Samples were boiled at 95ºC for 5 min and fractionated on 5% SDS-polyacrylamide gels with 25 nM Phos-tag reagent (Nard Institute AAL-107) and 50 μM MnCl2 as reported previously78 or by standard SDS-PAGE ...
-
No products found
because this supplier's products are not listed.
Andrew R Harris, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 5% biotinyl-amino-PEG (Rapp Polymere, #13 3000-25-20) which was incubated for a minimum of 4 hours at 50°C ...
-
No products found
because this supplier's products are not listed.
Andrew T. Phillips, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or β5-integrin (Assay Biotechnology; San Franscisco, CA; catalogue #: F-5) primary antibody for 1 hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Daniel Lyngholm, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 5-10nl of red or green fluorescent latex microspheres (Lumafluor, USA) (Katz et al. ...
-
No products found
because this supplier's products are not listed.
Andreas I. Andreou, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 2.5 μM DEX (Acros) or 5 μM β-estradiol (LKT laboratories) were added.
-
No products found
because this supplier's products are not listed.
Sang-Hee Lee, Seunghyung Lee,
bioRxiv - Cell Biology 2019
Quote:
... The membranes were then washed three times with TBS-T each 5 min and incubated with secondary antibodies conjugated horseradish peroxidase and visualized using the West Save Enhanced Chemiluminescence kit (AbFrontier, Austin, TX). Protein expression was measured using the EZ-Capture II system (ATTO ...
-
No products found
because this supplier's products are not listed.
Xiaona Chen, et al.,
bioRxiv - Cell Biology 2020
Quote:
... gastrocnemius and quadriceps muscles were injected with CTX (Latoxan; 10−5 M). At the indicated time points (3- and 7-day post injury) ...
-
No products found
because this supplier's products are not listed.
Mengmeng Jin, et al.,
bioRxiv - Neuroscience 2024
Quote:
... cells were passaged every 4∼5 days with Accutase (Innovative Cell Technologies) onto Matrigel (BD Biosciences)-coated culture plates at a ratio of 1:4∼1:8 supplemented with ROCK inhibitor Y-27632 (10 mM ...
-
No products found
because this supplier's products are not listed.
Sara Meril, et al.,
bioRxiv - Cancer Biology 2023
Quote:
0.5 μg RNA was mixed with 4 μL 5X reaction buffer and 1 μL RTase (AzuraQuant cDNA synthesis kit, Azura Genomics cat: AZ1996). Reaction mix was incubated at 42°C for 30 min and denatured at 85°C for 10 min ...
-
No products found
because this supplier's products are not listed.
Marissa L. Maciej-Hulme, et al.,
bioRxiv - Biochemistry 2020
Quote:
1 µl BODIPY-FL hydrazide (5 mg/mL, Setareh Biotech, Eugene, OR, USA) in DMSO was diluted in HPLC grade water before addition of organic solvent in a 1:9 (v/v ...
-
No products found
because this supplier's products are not listed.
Lingling Yin, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and SL/KAR treatment using 5 μM rac-GR24 (Chiralix, Nijmegen, The Netherlands). For ChIP-seq experiments ...
-
No products found
because this supplier's products are not listed.
Alexandre Champroux, et al.,
bioRxiv - Genetics 2023
Quote:
... each 35.5 cm long and 5 cm wide (Campden Instruments Ltd, Lafayette, IN). General mouse activity was analyzed for 5 min ...
-
No products found
because this supplier's products are not listed.
Joseph C. Reynolds, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Membranes were blocked for 1 hour using 5% BSA (Akron Biotech, USA, #AK8905-0100) in tris-buffered saline containing 0.05% Tween-20 (Bio-Rad #161-0781 ...
-
No products found
because this supplier's products are not listed.
Maik Müller, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Peptides were C18-purified using 5–60 μg UltraMicroSpin Columns (The Nest Group, cat: SEMSS18V) according to manufacturer’s instructions and subjected for mass spectromic analysis using an Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Kota Kaneko, et al.,
bioRxiv - Cell Biology 2023
Quote:
... PLC/PRF/5 cells were treated with HGF and SHP099 (10 μM; CHEMIETEK; CT-SHP099) or trametinib (10 nM ...
-
No products found
because this supplier's products are not listed.
Elizaveta O. Boldinova, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Primer-18 was 5′-labeled with [γ-32P]-ATP by T4 polynucleotide kinase (SibEnzyme, Russia) and annealed to the corresponding unlabeled Template-55 at a molar ratio of 1:1.1 ...
-
No products found
because this supplier's products are not listed.
Faisal Almansour, et al.,
bioRxiv - Cell Biology 2024
Quote:
... we used the same RP11 BAC probes tagged with Green 5-Fluorescein Conjugated dUTP (Empire Genomics).
-
No products found
because this supplier's products are not listed.
Christopher D. Go, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Beads were then washed with 150 μl of HPLC-grade water (Caledon Laboratory Chemicals CAT# 7732-18-5), centrifuged at 400 RCF for 1 min to pellet beads ...
-
No products found
because this supplier's products are not listed.
Julia Ryvkin, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... 5 heads were transferred into soft tissue homogenizing CK 14 tubes containing 1.4 mm ceramic beads (Bertin corp.) prefilled with 600 ul of cold (−20 °C ...
-
No products found
because this supplier's products are not listed.
Wenfeng Zeng, et al.,
bioRxiv - Immunology 2022
Quote:
... 5×104 BMDCs were pulsed with 1 mg/ml endotoxin-free chicken egg ovalbumin (OVA, Hyglos GmbH, Germany) in the presence of 50 μg/ml MC38 TEVs or MLC-V ...
-
No products found
because this supplier's products are not listed.
Ankita Gumaste, et al.,
bioRxiv - Neuroscience 2022
Quote:
Components for the artificial sniffing system used a mounted 5 mL glass syringe piston (Air-Tite, 7.140-33) coupled via a custom 3D-printed connector to a linear solenoid actuator (Soft Shift Part# 192907-023 ...
-
No products found
because this supplier's products are not listed.
Venecia Valdez, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 200 μM PMSF) before flowing over 5 mL CV of Strep-Tactin Superflow resin (Neuromics: 2-1206-025). The column was then washed with 10 CV of Strep binding buffer before being eluted with 1.5 CV of elution buffer (Strep binding buffer + 3.3 mM D-desthiobiotin) ...
-
No products found
because this supplier's products are not listed.
Jessica Hunter, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... The infection was then separated into infected cells and cell-free virus by centrifugation at 300 g for 5 minutes followed by filtration of the supernatant through a 0.45 micron filter (GVS). 1.2 × 106 infected cells or supernatant from 1.2 × 106 infected cells were added to new uninfected target cells such that the final number of cells in the culture was 6 × 106 at a concentration of 1 × 106cells/ml ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Lysate (600 μl) was incubated with 5 μg BAG-1L specific antibody rabbit monoclonal antibody (clone RM310; RevMAb Biosciences) at 4 °C for 16 hours to analyze the specificity of this antibody for its target ...
-
No products found
because this supplier's products are not listed.
Miriam R. Fein, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... frozen tissue sections were incubated with 1x blocking buffer (5% goat serum, 2.5% BSA in PBS) and Fc receptor blocker (Innovex Biosciences). Sections were incubated with rabbit anti-CD3 polyclonal antibody (1:500 dilution ...
-
No products found
because this supplier's products are not listed.
Bijoya Sen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Blood was collected from healthy donors (N=5) and PBMCs were isolated using Lymphoprep™ (Alere Technologies AS, Oslo, Norway) according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Alexandra M. Amen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 10-30% confluent U-251 cells were transduced at low MOI in 12-well plates with the lentivirus EF1a-BFP_Rsv-Bsd (5 µl; GenTarget, #LVP365) or EF1a-hTERT_Rsv-Bsd (50 µl ...
-
No products found
because this supplier's products are not listed.
Bridget L Evans, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 5 µm sagittal sections were taken from each tissue at a consistent depth and stained with Masson’s Trichrome (IHC World Masson’s Trichrome Staining Protocol for Collagen Fibres ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... 15 mg/kg n=5) was collected using 21-G needles into plastic syringes containing corn trypsin inhibitor (Molecular Innovations, Southfield ...
-
No products found
because this supplier's products are not listed.
Mason J. Appel, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Colonies were picked manually (sublibraries 1 and 5 only) or using a PIXL robotic colony picker (Singer Instrument Company, Somerset, UK) at the Stanford University School of Medicine Genome Technology Center (Palo Alto ...
-
No products found
because this supplier's products are not listed.
Seung-Ho Lee, et al.,
bioRxiv - Microbiology 2021
Quote:
The viral genomic sequences were aligned and trimmed using the Clustal W tool in the Lasergene program version 5 (DNASTAR, USA), and multiple sequence alignment was performed with high accuracy and high throughput MUSCLE algorithms in MEGA 7.0 (53) ...
-
No products found
because this supplier's products are not listed.
Julia Ledderose, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Time-pregnant female mice were injected intraperitoneally with 50 mg/kg BrdU (5-bromo-2’-deoxyuridine, BrdU; Accurate Chemical & Scientific Corporation) at E11.5 ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2023
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-5) in RPMI 1640 1 % FBS ...
-
No products found
because this supplier's products are not listed.
Kaela E. Natwora, et al.,
bioRxiv - Microbiology 2023
Quote:
... kits (Abraxis LLC, Warminster, PA) coupled with an ELISA microtiter plate reader ...
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
... and Kynurenine ELISA commercial kits (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Sujoy Chatterjee, et al.,
bioRxiv - Immunology 2020
Quote:
... Gel shift assays were done with EMSA kits (Signosis Inc). 5 μg nuclear extracts were incubated with 1× binding buffer and biotin-labeled probe for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Fadil M. Hannan, et al.,
bioRxiv - Genetics 2020
Quote:
... and FGF23 using a two-site ELISA kit (Kainos Laboratories), as described (19) ...
-
No products found
because this supplier's products are not listed.
Gustavo W. Fernandes, et al.,
bioRxiv - Physiology 2020
Quote:
In vivo transfections were performed with a liver transfection kit (Altogen Biosystems), as previously described (Fernandes et al. ...
-
No products found
because this supplier's products are not listed.
Jiyeon Choi, et al.,
bioRxiv - Genomics 2019
Quote:
... following the instructions of the Micellula DNA Emulsion & Purification Kit (EURx/CHIMERx). Amplified oligos were quantified using KAPA qPCR assay and verified by DNA sequencing on Ion PGM ...
-
No products found
because this supplier's products are not listed.
Masahide Sakabe, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Neonatal rat cardiomyocyte culture was performed using the neonatal cardiomyocyte isolation kit (Cellutron). P2 neonatal cardiomyocytes were plated on tissue culture dishes pre-coated with SureCoat (Cellutron ...
-
No products found
because this supplier's products are not listed.
Maggie R. Wagner, et al.,
bioRxiv - Plant Biology 2020
Quote:
... We used the Synergy 2.0 Plant DNA Extraction Kit (OPS Diagnostics, Lebanon, NJ, USA) to purify DNA ...
-
No products found
because this supplier's products are not listed.
Swayam Prakash Srivastava, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Urine albumin levels were assayed using a Mouse Albumin ELISA Kit (Exocell, Philadelphia, PA).
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Hejian Xiong, et al.,
bioRxiv - Neuroscience 2021
Quote:
... SST concentration was measured by an enzyme immunoassay kit (Cat. # S-1179, Peninsula Laboratories International, Inc) according to the provided protocol.
-
No products found
because this supplier's products are not listed.
Milena Petkova, et al.,
bioRxiv - Cell Biology 2022
Quote:
... PTX3 and CCL2 staining was amplified by Tyramide Signal Amplification kit (TSATM, NENTM Life Science Products). Tissue was first blocked with TNB (Tris-NaCl-blocking buffer) ...
-
No products found
because this supplier's products are not listed.
Xi Chen, et al.,
bioRxiv - Bioengineering 2021
Quote:
Plasma hFIX levels were quantified by an VisuLize™ Factor IX Antigen Kit (FIX-AG; Affinity Biologicals) and are shown as a percentage of normal level according to the manufacturer’s protocol ...