-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... and Monkey IL-17 ELISA Kit (U-CyTech biosciences), respectively.
-
No products found
because this supplier's products are not listed.
Kuohan Li, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 10% glycerol and 5 mM β-mercaptoethanol and lysed by a Panda Plus 2000 homogenizer (GEA Niro Soavi). The lysate was clarified by high-speed centrifugation at 20 000×g at 4°C for 40 min ...
-
No products found
because this supplier's products are not listed.
Rebecca S. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 17-site + Full PS mutant were custom synthesized (Epoch Life Science, Inc), and subcloned by restriction digest into pSP6-SFV4 ...
-
No products found
because this supplier's products are not listed.
Madhu Kollareddy, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and β-tubulin (clone TU-06, Exbio) or β-actin (clone AC-74 ...
-
No products found
because this supplier's products are not listed.
John Kim, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-β-Tubulin (1:5000, Absolute Antibody), rabbit anti-COXIV (1:1000 ...
-
No products found
because this supplier's products are not listed.
Zhen Xu, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Libraries were prepared using the NGS Prep Kit for sgRNA Libraries in pRSG16/17 (KOHGW, CELLECTA, LNGS-120) and Supplementary Primer Set for LNGS-120 (CELLECTA ...
-
No products found
because this supplier's products are not listed.
Mikel Garcia-Marcos, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Fluorescein di-β-D-galactopyranoside (FDG) was from Marker Gene Technologies, and the protein inhibitor mixture was from Sigma (catalog no ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB) (Primerdesign Ltd), using the delta-CT or delta-delta Ct method[38].
-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 μl of 5× TuneUp solution (NanoHelix, Korea), 1 μl of Taq-plus polymerase (NanoHelix ...
-
No products found
because this supplier's products are not listed.
Darshan V. Trivedi, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
PfMyoA was expressed as described previously [17] in Sf9 cells adapted to serum-free ESF 921 media purchased from Expression Systems. Sf9 cells were co-infected with PfMyoA ...
-
No products found
because this supplier's products are not listed.
Jan D. Beck, et al.,
bioRxiv - Immunology 2023
Quote:
... and 60 mg/kg 5-fluorouracil (5-FU) (Medac) in 0.9% NaCl (Braun ...
-
No products found
because this supplier's products are not listed.
Thomson Patrick Joseph, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... isopropyl β-D-1-thiogalactopyranoside (IPTG) and phenylmethane sulfonyl fluoride were purchased from Tiangen Biotech Co. ...
-
No products found
because this supplier's products are not listed.
Flor A. Gowans, et al.,
bioRxiv - Biochemistry 2023
Quote:
... provided by TCF/LEF Reporter Kit Wnt / β-catenin signaling pathway (BPS Bioscience, #60500). After 72hrs post-transfection ...
-
No products found
because this supplier's products are not listed.
Lauriane Cornuault, et al.,
bioRxiv - Physiology 2022
Quote:
... PLN phosphorylation at Serine 16 and Threonin 17 was evaluated by SDS PAGE using rabbit anti-phospho-PLN Ser16 (Badrilla, Cat# A010-12), rabbit anti-phospho-PLN Thr17 (Badrilla ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
David E Ehrlich, David Schoppik,
bioRxiv - Neuroscience 2019
Quote:
Supplemental videos at high spatial resolution were alternatively filmed in a thinner glass tank (96/G/5 24×5×5 mm, Starna Cells, Inc.) using a Sony IMX174 CMOS chip (ace acA1920-155um ...
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
No products found
because this supplier's products are not listed.
Mark A. Skylar-Scott, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5 μM SB431542 (BioGems, #3014193), and 100 nM LDN193189 (BioGems ...
-
No products found
because this supplier's products are not listed.
Yen-Chun Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (3Helix; R-CHP; 5 μM).
-
No products found
because this supplier's products are not listed.
Ayijiang Yisimayi, et al.,
bioRxiv - Immunology 2023
Quote:
... BA.5 (ACROBiosystems, SPN-C522e) were used for mouse immunization ...
-
No products found
because this supplier's products are not listed.
Masaharu Somiya, Shun’ichi Kuroda,
bioRxiv - Cell Biology 2021
Quote:
... Transporter 5 Transfection Reagent (Polyscience, Inc.), or branched 25-kDa polyethyleneimine (PEI ...
-
No products found
because this supplier's products are not listed.
Xiaohui Zhao, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 5-fluorotryptamine hydrochloride (AstaTech, Catalog #52030), 6-fluorotryptamine (AstaTech ...
-
No products found
because this supplier's products are not listed.
Amitabh Das, et al.,
bioRxiv - Genetics 2023
Quote:
... a 5-0 silk suture (Roboz) was tied around the maxillary left second molar and left in place for 5 days(34) ...
-
No products found
because this supplier's products are not listed.
Gianluca Zambanini, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Antibody incubation was performed in 150 μl antibody buffer (wash buffer with digitonin [0.01%] and EDTA [2 mM]) with 1.5 μl anti-β-catenin antibody (Cat. #ABIN2855042, antibodies-online) overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Rahul Bhattacharjee, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Haploid integrants were then isolated based on resistance to 5-fluorourotic acid (5-FOA) (United States Biological; F5050) and integration of the cdc15 mutations was verified by growth on selective media followed by PCR and DNA sequencing ...
-
No products found
because this supplier's products are not listed.
Aleksandra A. Petelski, et al.,
bioRxiv - Bioengineering 2021
Quote:
... myFuge 5 (MTC Bio; cat. no: C2595).
-
No products found
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and KAT 5 (KAT5-1350H; Creative Biomart) proteins following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lukas Spiller, et al.,
bioRxiv - Immunology 2023
Quote:
... 5 nmol CpG (TIB MOLBIOL, Berlin, Germany), and an equal volume of Incomplete Freund’s adjuvant (IFA ...
-
No products found
because this supplier's products are not listed.
Benjamin T. Throesch, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 mM MgCl2-6H2O (Honeywell Research Chemicals), 1 mM CaCl2 (Honeywell Research Chemicals) ...
-
No products found
because this supplier's products are not listed.
Charles Bayly-Jones, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 μL of diluted C9-depleted serum (Complement Tech; diluted 1 in 5 with 1×DGHB; 2.5% (w/v) D-glucose ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
MitoNeoD at 5 μM (563761, MedKoo Biosciences Inc.), RPA at 5 μM (ME043.1 ...
-
No products found
because this supplier's products are not listed.
Maria L. Sorkin, et al.,
bioRxiv - Plant Biology 2022
Quote:
... and 5 μM MG132 (Peptides International, Louisville, KY)) and sonicated using a duty cycle of 20 s (2 s on ...
-
No products found
because this supplier's products are not listed.
Kanishk Jain, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 5 μL of GST-tagged reader domain was incubated with 5 μL of 10 nM biotinylated nucleosomes (e.g., EpiCypher #16-9001) for 30 minutes at room temperature in 20 mM HEPES pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Julia Fath, et al.,
bioRxiv - Cell Biology 2022
Quote:
... TAMRA(5-Carboxytetramethylrhodamine)-peptides were synthetized by ProteoGenix (France).
-
No products found
because this supplier's products are not listed.
Chloe R. Koulouris, et al.,
bioRxiv - Biophysics 2021
Quote:
... 5% ethylene glycol and 20% PEG Smear Broad (Molecular Dimensions). This crystallisation condition differs from that reported in a recent crystal structure of holo SR (6SLH ...
-
No products found
because this supplier's products are not listed.
Tyler C. Detomasi, et al.,
bioRxiv - Genetics 2022
Quote:
... and an ITC-5 temperature controller (Oxford Instruments, Abingdon, United Kingdom). Spectra were acquired under slow-passage non-saturating conditions.
-
No products found
because this supplier's products are not listed.
Sumit J. Bandekar, et al.,
bioRxiv - Biochemistry 2024
Quote:
... ADGRL3 + GFP and TEN2 + dsRed and 5 μL LipoD293T (SL100668; SignaGen Laboratories). Two days after transfection ...
-
No products found
because this supplier's products are not listed.
Mingrui Guo, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... by submandibular venipuncture with 5-mm Goldenrod animal lancets (Braintree Scientific, cat.no. GR5MM). Counts of nucleated cells was performed using a NIHOKODEN auto blood cell counter under Pre-dilute 20 µl mode ...
-
No products found
because this supplier's products are not listed.
DT Dinh, et al.,
bioRxiv - Molecular Biology 2021
Quote:
CBAF1 female mice were stimulated with 5 IU eCG (Lee BioSolutions, Maryland Heights, USA) and culled at 44 hours post-eCG ...
-
No products found
because this supplier's products are not listed.
Marcus Griffiths, et al.,
bioRxiv - Plant Biology 2023
Quote:
Modified Hoagland’s solution imaging gels solidified with 5% Gelzan™ (Caisson Labs, UT, USA) were prepared for the root imaging experiments ...
-
No products found
because this supplier's products are not listed.
Tábata Apablaza, et al.,
bioRxiv - Physiology 2024
Quote:
... Paraffin sections (5 μm) were treated with 1X EDTA buffer pH 8.0 (Diagnostic Biosystem), blocked with 2.5% normal goat serum (Vector Laboratories cat# S-1012) ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolome Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=5) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
,
bioRxiv - Microbiology 2019
Quote:
... brain and lungs were collected and placed in labeled 5 ml tubes (CELLTREAT, Pepperell, MA) containing 2 ml of HBSS with no dye on ice ...
-
No products found
because this supplier's products are not listed.
Cory Schwarz, et al.,
bioRxiv - Microbiology 2022
Quote:
... plus 5% defibrinated horse blood in fastidious anaerobe agar (FAA) (Neogen, Lansing, MI, United States). When growth was visible on the plates ...
-
No products found
because this supplier's products are not listed.
Irene P. Ayuso-Jimeno, et al.,
bioRxiv - Neuroscience 2021
Quote:
Mice were anesthetized with 5% isoflurane and subsequently head fixed in a stereotaxic frame (RWD Life Science) with body temperature maintained at 37 °C ...
-
No products found
because this supplier's products are not listed.
Abigail K. Grosskopf, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A stock solution of alginate (5 wt%) and hyaluronic acid (HA) (Lifecore Biomedical, 1.5 MDA, 1.25 wt%) was also prepared in saline ...
-
No products found
because this supplier's products are not listed.
Geoffrey A. Smith, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were washed and then treated with 5 µg/ml 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI) labeled LDL (Kalen Biomedical) in low-glucose DMEM with 0.5% BSA (MilliporeSigma ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Bruno Raposo, et al.,
bioRxiv - Immunology 2022
Quote:
... transfer of 1.5 mg per mouse of a 5 monoclonal anti-type II collagen (CII) antibody cocktail (Chondrex, USA). 3 days later ...