-
No products found
because this supplier's products are not listed.
Colbie R. Chinowsky, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mNEON-green-β-actin was purchased from Allele Biotechnology. pHalo-C1-NM2C (Halo-NM2C ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... The anti-mouse β-casein was designed by Covalab.
-
No products found
because this supplier's products are not listed.
Itai Sharon, T. Martin Schmeing,
bioRxiv - Biochemistry 2023
Quote:
... β-Asp-Asp was purchased from Advanced ChemBlocks (USA).
-
No products found
because this supplier's products are not listed.
Julie Zimmermann, et al.,
bioRxiv - Immunology 2021
Quote:
... and monomycoloyl glycerol (17) were obtained from NCK A/S (Farum, Denmark) and polyinosinic:polycytidylic acid was bought from Dalton Pharma Services (North York ...
-
No products found
because this supplier's products are not listed.
Ina J. Andresen, et al.,
bioRxiv - Cell Biology 2020
Quote:
... RNA from 3 batches (batch 17, 19 and 25) was isolated using the “Single Cell RNA Purification Kit” (NORGEN BIOTEK CORP, Canada) with an 8 ul elution buffer ...
-
No products found
because this supplier's products are not listed.
Lucia Sedlackova, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM NR (ChromaDex), 10 μM olaparib (Cambridge Biosciences) ...
-
No products found
because this supplier's products are not listed.
Bryce K. Allen, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... STING-mediated induction IFN-β in PBMCs from cynomolgus monkey (IQ Biosciences; donor 5032, Lot P19D2206) was tested after treatment for 6h using an ELISA (VeriKine Cynomolgus IFNb ELISA ...
-
No products found
because this supplier's products are not listed.
Ruhi Patel, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... plated on solid NGM supplemented with 8 mM isopropyl β-D-1-thiogalactopyranoside (IPTG, Laguna Scientific), and incubated for 16 to 24 h at 25° C ...
-
No products found
because this supplier's products are not listed.
Maho Yamashita, et al.,
bioRxiv - Biochemistry 2023
Quote:
Apiin and apigenin 7-O-β-D-glucoside were purchased from Ark Pharm (Arlington Heights, IL). Apigenin was purchased from Cayman Chemical (Ann Arbor ...
-
No products found
because this supplier's products are not listed.
Paola Moreno-Roman, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5% NGS (Capralogics GS0250), washed 3 times in PBT ...
-
No products found
because this supplier's products are not listed.
Karl Alex Hedin, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... for preventing bacterial growth and 1 g/L 5-Fluoroorotic Acid (5-FOA; Nordic BioSite) for preventing other yeast species from growing.
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... We further compared neurons cultured in patterning versus maturation medium using 5 μl/ml BDNF and 5 μl/ml GDNF slow release PLGA microbeads (StemCultures; 5 ng/ml steady-state concentrations) at two time points ...
-
No products found
because this supplier's products are not listed.
Arumoy Chatterjee, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The deuterated internal standards 2-(4-Hydroxyphenyl)ethyl-1,1,2,2-d4-amine HCl and beta-Hydroxytyramine (α-d2, β-d1) HCl were supplied by Medical Isotopes, Inc ...
-
No products found
because this supplier's products are not listed.
Mathew Clement, et al.,
bioRxiv - Immunology 2020
Quote:
... The α and β chains of CD8 were cloned similarly into a single pSF-Lenti-EFα lentiviral vector (Oxford Genetics) separated by an IRES sequence (Genewiz) ...
-
No products found
because this supplier's products are not listed.
Rueyhung R. Weng, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5% human platelet lysate (PLS1, Compass Biomedical), 70 ng/mL IL-15 (AF-200-15 ...
-
No products found
because this supplier's products are not listed.
Deirdre Nolfi-Donegan, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ADP (0-5 μM; Bio/Data Corporation), collagen (0-50 μg/ml ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
... RPA at 5 μM (ME043.1, Squarix biotechnology), MitoTracker Green at 75 nM (M7514 ...
-
No products found
because this supplier's products are not listed.
E.H. Bowler-Barnett, et al.,
bioRxiv - Cancer Biology 2021
Quote:
HCT116-GSK3β-KO and paired isogenic control cell line HCT116-GSK3β-WT were created by integrating a ssDNA oligonucleotide containing several stop codons at the GSK3 β locus with TALEN technology (Cellectis). Cell lines were cultured in McCoys 5A culture medium (Gibco ...
-
No products found
because this supplier's products are not listed.
Vincent Tano, et al.,
bioRxiv - Neuroscience 2022
Quote:
Approximately 1-2 million cells were lysed using FARB buffer with β-mercaptoethanol and RNA was purified using the FavorPrep Blood/Cultured Cell Total RNA Mini kit (Favorgen) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Apsra Nasir, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 5% Fetal Bovine Serum (FBS) (Peak Serum, PS-FB2), ITS (Lonza ...
-
No products found
because this supplier's products are not listed.
Andrew T. Phillips, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or β5-integrin (Assay Biotechnology; San Franscisco, CA; catalogue #: F-5) primary antibody for 1 hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Yara Eid Mutlak, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Phospho-Serine antibody was from ECM biosciences (Cat# PP2551, lot# 5). Anti-Laminin (Cat# L9393 ...
-
No products found
because this supplier's products are not listed.
Hanna G. Budayeva, et al.,
bioRxiv - Biochemistry 2023
Quote:
... peptides were cleaned up using a 5 µl C18 Phytip (Biotage, Inc) and injected for LC-MS/MS acquisition.
-
No products found
because this supplier's products are not listed.
Aurélien Courtois, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:500) and ACA (human, 15-234, Antibodies Incorporated, 1:200 (Figure 5) or 1:500 (other figures) ...
-
No products found
because this supplier's products are not listed.
Mohammed Mohasin, et al.,
bioRxiv - Immunology 2021
Quote:
... Nuclei were stained with 5 µM Draq5 (Biostatus Ltd. 1:1000 in PBS). Coverslips were mounted onto microscope slides with a glycerol free poly-(vinyl alcohol ...
-
No products found
because this supplier's products are not listed.
Fangyuan Ding, et al.,
bioRxiv - Systems Biology 2020
Quote:
... were coated with 5 ug/ml Human Fibronectin (Oxford Biomedical Research, Rochester Hills, MI) in PBS buffer for 1hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Shannon J. McKie, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Topo VI (5-80 nM) was incubated with 2.5 nM negatively supercoiled pBR322* (Inspiralis) in a 30 μL reaction volume with Cleavage Buffer (20 mM Bis-Tris propane (pH 7) ...
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Carbonyl Fe powder (5-9 μm) was purchased from STREM Chemicals (Newburyport, MA, USA). Fe2O3 nanopowders (50-200 nm ...
-
No products found
because this supplier's products are not listed.
Malgorzata Wygrecka, et al.,
bioRxiv - Biochemistry 2021
Quote:
... COVID-19 plasma was preincubated with hirudin (5 IE/mL final; Diapharma, West Chester, OH) and the clotting was induced by batroxobin (5U/mL final ...
-
No products found
because this supplier's products are not listed.
Amin Zargar, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... 5-methyl-6-(propan-2-yl)oxan-2-one was synthesized by Enamine (Cincinnati, USA) to greater than 95% purity.
-
No products found
because this supplier's products are not listed.
Andrey Zakharchenko, et al.,
bioRxiv - Biochemistry 2022
Quote:
Glutaraldehyde-fixed BP samples (n=5) were punched using 8 mm biopsy punches (Medline, Northfield, IL). Samples were rinsed with PBS and then incubated for 28 days in PBS with the following conditions either without inhibitors (Control ...
-
No products found
because this supplier's products are not listed.
Inyup Paik, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A single colony was seed cultured overnight in 5 mL of superior broth (Athena Enzyme Systems, 0105). The next day ...
-
No products found
because this supplier's products are not listed.
Wenjie Wang, et al.,
bioRxiv - Cancer Biology 2019
Quote:
The P12Y oligonucleotide linked to tyrosine at the 3’-end (5’-HO-GAAAAAAGAGTT-PO4-Tyr-3’, TopoGEN) was labeled at the 5’-end with 32P ...
-
No products found
because this supplier's products are not listed.
Srinivasu Karri, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Cells were then arrested in G1-phase using two doses of α factor (5 µg/ml; EZBiolab) for three hours at 25°C ...
-
Native Antigen
Cat# AD002-100,
100µl USD $1227.0
Ask
Fakhriedzwan Idris, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5 mg/kg of purified NS1(D2Y98P or de-glycosylated T209L) (custom-made, The Native Antigen Company) or OVA protein (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Christopher D. Go, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Beads were then washed with 150 μl of HPLC-grade water (Caledon Laboratory Chemicals CAT# 7732-18-5), centrifuged at 400 RCF for 1 min to pellet beads ...
-
No products found
because this supplier's products are not listed.
Julia Ryvkin, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... 5 heads were transferred into soft tissue homogenizing CK 14 tubes containing 1.4 mm ceramic beads (Bertin corp.) prefilled with 600 ul of cold (−20 °C ...
-
17-Hydroxyprogesterone ELISA / assay Kit
Cat# K053-H5,
1.0 ea, USD $1810.0
Ask
Lara S. Hwa, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 5 µl plasma samples were processed with a commercially available colorimetric ELISA kit (Arbor Assays, Ann Arbor, MI), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Wenfeng Zeng, et al.,
bioRxiv - Immunology 2022
Quote:
... 5×104 BMDCs were pulsed with 1 mg/ml endotoxin-free chicken egg ovalbumin (OVA, Hyglos GmbH, Germany) in the presence of 50 μg/ml MC38 TEVs or MLC-V ...
-
No products found
because this supplier's products are not listed.
Ankita Gumaste, et al.,
bioRxiv - Neuroscience 2022
Quote:
Components for the artificial sniffing system used a mounted 5 mL glass syringe piston (Air-Tite, 7.140-33) coupled via a custom 3D-printed connector to a linear solenoid actuator (Soft Shift Part# 192907-023 ...
-
No products found
because this supplier's products are not listed.
Jessica Hunter, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... The infection was then separated into infected cells and cell-free virus by centrifugation at 300 g for 5 minutes followed by filtration of the supernatant through a 0.45 micron filter (GVS). 1.2 × 106 infected cells or supernatant from 1.2 × 106 infected cells were added to new uninfected target cells such that the final number of cells in the culture was 6 × 106 at a concentration of 1 × 106cells/ml ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Lysate (600 μl) was incubated with 5 μg BAG-1L specific antibody rabbit monoclonal antibody (clone RM310; RevMAb Biosciences) at 4 °C for 16 hours to analyze the specificity of this antibody for its target ...
-
No products found
because this supplier's products are not listed.
Miriam R. Fein, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... frozen tissue sections were incubated with 1x blocking buffer (5% goat serum, 2.5% BSA in PBS) and Fc receptor blocker (Innovex Biosciences). Sections were incubated with rabbit anti-CD3 polyclonal antibody (1:500 dilution ...
-
No products found
because this supplier's products are not listed.
Alexandra M. Amen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 10-30% confluent U-251 cells were transduced at low MOI in 12-well plates with the lentivirus EF1a-BFP_Rsv-Bsd (5 µl; GenTarget, #LVP365) or EF1a-hTERT_Rsv-Bsd (50 µl ...
-
No products found
because this supplier's products are not listed.
Fernando Salgado-Polo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Cells were trypsinized into single-cell suspensions and then 8×105 cells were incubated with 5 μl of anti-GPC6 antibody LS-C36518 (LifeSpan Bioscience) and in 4 μl of APC anti-HA antibody (Biolegend) ...
-
17-Hydroxyprogesterone is a small molecule.
Cat# abx165613-1MG,
1 mg USD $2639.0
Ask
Daniel C. Levine, et al.,
bioRxiv - Neuroscience 2024
Quote:
... hypothalamus from PER2-TgWT mice that were fasted for 16 hours or given ad libitum access to HFD for 1 week was excised at ZT16 and extracted with ∼5 volumes of strong RIPA buffer containing kinase and phosphatase inhibitors (Abbexa abx090624), sonicated in a water bath 3 x 30sec on high ...
-
No products found
because this supplier's products are not listed.
Ashok Daniel Prabakaran, et al.,
bioRxiv - Physiology 2024
Quote:
... Tissue sections of 5–7 µm thickness of was stained with hematoxylin and eosin (H & E; cat #12013B, 1070C; Newcomer Supply, Middleton, WI). CSA quantitation was conducted on >400 myofibers per tissue per mouse ...
-
No products found
because this supplier's products are not listed.
Michael G. LaMontagne, et al.,
bioRxiv - Microbiology 2022
Quote:
... Temperature and dissolved oxygen were measured in situ at 3 – 5 cm beneath the surface with a YSI model 55 dissolved oxygen (DO) probe (YSI Inc., Young Spring, OH). Water samples were split in the field for FIB (E ...
-
No products found
because this supplier's products are not listed.
Takanobu A. Katoh, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... and with a single-mode fiber laser (wavelength of 1064Lnm; YLR-5-1064-LP-SF, IPG Photonics) and filter set (ZT1064rdc-sp, Chroma Technology, and SIX870, Asahi). A long-path filter was inserted before a halogen lamp (LV0630 ...