-
No products found
because this supplier's products are not listed.
Arpit Kumar Pradhan, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 2 ng of 13C5-5α-dihydroprogesterone (DHP) (CDN Isotopes, Sainte Foy la Grande, France) for 5α/β-DHP ...
-
No products found
because this supplier's products are not listed.
F. Phil Brooks III, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a stack of one 5 mm and two 3 mm round cover glass (Thomas Scientific, 1217N66), pre-glued by optical glue (Norland 61) ...
-
No products found
because this supplier's products are not listed.
M. Nabuan Naufer, et al.,
bioRxiv - Biophysics 2019
Quote:
The 8.1 kbp dsDNA construct with a primer-template junction at one terminus was tethered between 2 μm anti-digoxigenin and 3 μm streptavidin functionalized beads (Spherotech) held in place by a micropipette tip and a dual beam optical trap ...
-
No products found
because this supplier's products are not listed.
N Hammoudi, et al.,
bioRxiv - Microbiology 2020
Quote:
... 45 molecules from Sigma (Lezennes, France] and one from EUROMEDEX (Souffelweyersheim ...
-
No products found
because this supplier's products are not listed.
Bas W.A. Bögels, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide HCl (EDC, Carbosynth), 1,6-diaminohexane (Sigma ...
-
LC Laboratories' Product Number L-7962 - LY 294002, Free Base...
Cat# L-7962, SKU# L-7962_50mg,
50 mg, $40.00
Ask
Josh Tycko, et al.,
bioRxiv - Systems Biology 2023
Quote:
... in one well 100 nM Rapamycin (LC Laboratories) was added and the other well contained regular RPMI complete media ...
-
No products found
because this supplier's products are not listed.
Govind Nair, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and spun down for one minute (MyFuge C1012, Benchmark Scientific). Samples in 8-well tubes were heat-shocked for three minutes at 72 °C (C1000 Touch Thermal Cycler ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... Indole-3-aldehyde (I3A) and indole-3-pyruvate (IPyA) were obtained from Biosynth. Tryptophol (IEt) ...
-
No products found
because this supplier's products are not listed.
Emilia Neuwirt, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 - 5 μM MCC950 (Adipogen), 50 - 200 nM MG132 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Vanesa Fernández-Majada, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CHIR99021 (3 µM, Tebu-bio) and valproic acid (1 mM ...
-
No products found
because this supplier's products are not listed.
Alin Rai, et al.,
bioRxiv - Cell Biology 2024
Quote:
... APOA1 (3710-3-1000, Mabtech) and ALIX (2171S ...
-
No products found
because this supplier's products are not listed.
Chiu-Yueh Hung, et al.,
bioRxiv - Plant Biology 2023
Quote:
... one tube was added 10 μg of anti-AKIN10 antibody (Cedarlane, USA) while the other tube received none (as a negative control) ...
-
No products found
Chao Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were cultured on a one-well chambered coverglass (Cellvis, C1-1.5H-N) for 24 hours and then were treated with 7.5 μM RO-3306 for 18 hours ...
-
No products found
because this supplier's products are not listed.
Vidur Garg, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and 3 µM GSK3βi/CHIR99021 (Reprocell) (‘AGi’ media ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... cleaved-caspase 3 (1:1000, Bioworld), Pro-Caspase 3 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Xiaodong Duan, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Each drive was loaded with closely aligned one optical fiber (230 um, RWD Life Science) and 4 tetrodes ...
-
No products found
because this supplier's products are not listed.
Luca A. Andronico, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)) were purchased from Bangs Laboratories and Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
Erica J. Polleys, et al.,
bioRxiv - Genetics 2022
Quote:
... or a-Rad51 (3 uG; Agrisera AS07 214) for 2 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Anna Zhuravskaya, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3 µM CHIR99021 (Cambridge Bioscience, cat# SM13-1), 0.5 mM L-Glutamine (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Terry R. Suk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... cDNA was synthesized using 5X All-in-One RT Master Mix (Bio Basic cat# HRT025-10) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Marc D. Hein, et al.,
bioRxiv - Bioengineering 2021
Quote:
... One was the commonly used polyethersulfone HFM (0.2 μm pore size, 470 cm2 surface area, Spectrum Labs), the other one was the tubular VHU (~10 μm pore size ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Cristóbal Gallegos, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... Sequencing was performed in two batches, one by GenomeQuébec (Montréal, Canada) and one by GENEWIZ (Suzhou, China). Both batches used one lane of Illumina HiSeq 4000 (paired-end ...
-
No products found
because this supplier's products are not listed.
Raphael A. Reyes, et al.,
bioRxiv - Immunology 2024
Quote:
... One hundred fifty µL blocking buffer (one-third Non-Animal Protein (NAP)-Blocker (G-Biosciences #786-190P) and two-thirds PBS ...
-
No products found
because this supplier's products are not listed.
Hoai Thi Thu Tran, et al.,
bioRxiv - Microbiology 2022
Quote:
... Luminescence (one-step luciferase assay system, Biomol) was detected after 15 min using a multi-plate reader (Tecan Group Ltd ...
-
No products found
because this supplier's products are not listed.
Andreas Wallucks, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Imaging was done one a Prime95B (Photometrics) with 118×118 μm2 FOV size on the full 1608×1608 pixel sensor ...
-
No products found
because this supplier's products are not listed.
Alex Chialastri, et al.,
bioRxiv - Genomics 2022
Quote:
... One layer of photoresist (Microchem, SU-8 2075) is spun onto a silicon wafer at a thickness of 100 μm ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Tyler C. Detomasi, et al.,
bioRxiv - Genetics 2022
Quote:
... 3 mM of chitooligosaccharides (DP 3-6) (Megazyme, Wicklow, Ireland) were treated with 0.12 mg/mL of ChitO (Gecco Biotech ...
-
No products found
because this supplier's products are not listed.
Maria del Mar Aguilo-Ferretjans, et al.,
bioRxiv - Microbiology 2020
Quote:
... one-way stopcock valves (WZ-30600-00; Cole-Parmer, USA), and Luer connectors ...
-
No products found
because this supplier's products are not listed.
Avirup Malla, Suvroma Gupta, Runa Sur,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3 activity was measured by a caspase-3 activity assay kit (Elabscience) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Matthew G. Blango, et al.,
bioRxiv - Microbiology 2021
Quote:
... One scoop of 0.15 mm zirconium oxide beads (Next Advance; ZrOB015) was added to each tube and bacteria were lysed using a Bullet Blender (Next Advance ...
-
No products found
because this supplier's products are not listed.
Gloria Somalo-Barranco, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... and automated with Isolera™ One with UV-Vis detection (Biotage).
-
No products found
because this supplier's products are not listed.
L. A. Fish, et al.,
bioRxiv - Neuroscience 2023
Quote:
... One 28-gauge monopolar needle electrode (Teca, Oxford Instruments Medical, NY) was placed on either side of the sciatic nerve ...
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... LAG-3 (LA3-H5255; Acrobiosystems), TIM-3 (TM3-H5258 ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, James A. Van Deventer,
bioRxiv - Synthetic Biology 2021
Quote:
... 3-Amino-L-tyrosine (Bachem), 4-Amino-L-phenylalanine (Bachem) ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Shao-Jung Hsu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... one given adeno-associated virus (AAV)8-mouseVEGF-C (Vector Biolabs, Malvern, PA) and the other given AAV8-GFP (control ...
-
No products found
because this supplier's products are not listed.
Guillem Casadevall, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Crystals appeared within one day from the Index HT screen from Hampton Research Inc ...
-
No products found
because this supplier's products are not listed.
Teng-Chieh Yang,
bioRxiv - Bioengineering 2023
Quote:
... One (1) μm yellow PSP and 6 μm red PSP were from Polyscience Inc ...
-
Gelatin methacrylate (GelMA) is a gelatin-based bioink that provides mammalian cells with the...
Cat# IK3051020303,
3 mL, USD $310.0
Ask
Rezvan Parvizi, et al.,
bioRxiv - Genomics 2024
Quote:
... which is a mix of one part collagen (Advanced BioMatrix, 6 mg/mL), one part HEPES (pH 8) ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Csaba Matta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-MMP-3 (Aviva Systems Biology ARP42042_P050), anti-MMP-13 (Aviva Systems Biology ARP56350_P050) ...
-
No products found
because this supplier's products are not listed.
Fatmanur Tiryaki, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse anti Centrin 3 (H0007070-MO1, Abnova), and rabbit anti IFT88 (139671-AP ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Joep Houkes, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... resuspension buffer supplemented with 3 μL 1000 U/mL Zymolase (Amsbio) and incubated for 30 min at 37 °C to digest the cell walls ...
-
No products found
because this supplier's products are not listed.
Lijin Zou, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The human proteins were assigned to 3 Piggybac vectors (System Biosciences, USA) by Golden Gate Assembly method (11 ...
-
No products found
because this supplier's products are not listed.
Seth H. Andrews, et al.,
bioRxiv - Bioengineering 2021
Quote:
... we comprehensively profiled the secretome of one MSC line (PCBM1662 P3) using a 440-plex antibody array (Quantibody, Raybiotech, Norcross, GA). Frozen aliquots of conditioned medium and control GM (triplicate samples for each group ...
-
No products found
because this supplier's products are not listed.
Hannah I. Ghasemi, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... iPSCs were then treated with 3 ml pre-warmed Accutase (Innovative Cell Technologies) and the vessel was then incubated at 37ºC for 5 min ...