-
Glucocorticoid modulator
Sold for research purposes only.
Cat# 1176.0, SKU# 1176-10 mg,
Inquire
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
Alison Moss, et al.,
bioRxiv - Neuroscience 2020
Quote:
... one of the five tracers was injected into Sprague Dawley rats (3-4 months old, purchased from Envigo) sino-atrial node at the same volume of 10 μL and the heart tissues were harvested in the time window 10 am-12 pm 14 days after injection and stored in OCT immediately ...
-
No products found
because this supplier's products are not listed.
David Krones, et al.,
bioRxiv - Microbiology 2021
Quote:
HuLECs were seeded in a density of 3×104 cells/well one day prior use in a µ-Slide 8 well live-cell chamber (Ibidi). The following day ...
-
No products found
because this supplier's products are not listed.
Susannah B.P. McLaren, Fengzhu Xiong,
bioRxiv - Developmental Biology 2023
Quote:
... one from Sutter Instrument. Various tubing is necessary for fluid handling ...
-
No products found
because this supplier's products are not listed.
Pei-Yu Chu, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one (PD98059, MEK inhibitor) and STAT3 inhibitor VI were from Calbiochem (Darmstadt, Germany). The EGF was from Millipore (Billerica ...
-
No products found
because this supplier's products are not listed.
Jiashu Xu, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3 μl of medium containing one isolated muscle fibre was placed on the glow-discharged grid (Quantifoil R2/1 Au 200 mesh). After incubation for 60 seconds at 37 °C ...
-
No products found
because this supplier's products are not listed.
Robert Rauschkolb, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... from Mediterranean and temperate species had germinated we transplanted up to 20 seedlings each into 9 × 9 cm pots (one plant per pot) with a 3:1 mixture of potting soil (Einheitserde®, BioLine, Topfsubstrat Öko torffrei) and sand (0-2 mm play sand ...
-
No products found
because this supplier's products are not listed.
James P Stumpff II, et al.,
bioRxiv - Microbiology 2022
Quote:
... and one ceramic bead (MP Biomedicals). Lung tissue was homogenized with the FastPrep-24 bead beater at 7.00 speed/s twice for 20 seconds each then placed on ice for 5 min and repeated ...
-
No products found
because this supplier's products are not listed.
Karine Queiroz Zetune Villa Real, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Between 5 and 10 mL of plasma was diluted in PBS in a one-to-one ratio and filtered through a 0.45 μm pore size syringe filters (Stedim Minisart®, Sartorius). The plasma was then injected in HiTrap protein G HP (Cytiva) ...
-
No products found
because this supplier's products are not listed.
Gengqiang Xie, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... membranes were exposed to ChromoSensorTM One-Solution (GenScript) for 3–5 minutes ...
-
No products found
because this supplier's products are not listed.
Jia-Shuo Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... fluo-3 acetoxymethyl (Fluo-3 thereafter) ester (Biotium, US) following a protocol adapted from (Zhang et al. ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Brendan P. Lehnert, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3 mm WD objective (Nikon) with scan mirror excursions that produced a 510 x 510 μm2 field of view ...
-
No products found
because this supplier's products are not listed.
Laura L Gathercole, et al.,
bioRxiv - Physiology 2021
Quote:
... 7α,12α-dihydroxycholest-4-en-3-one-d7) (Toronto Research Chemicals, Ontario, Canada) and homogenized in chloroform/methanol (4 ml ...
-
No products found
because this supplier's products are not listed.
Alina Soto, et al.,
bioRxiv - Microbiology 2023
Quote:
... a 20 µl mixture containing 3 µl of RNA was prepared using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Raphaël Laurenceau, et al.,
bioRxiv - Microbiology 2019
Quote:
... and Type One Inhibitor (Lucigen), following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lucy Troman, et al.,
bioRxiv - Biochemistry 2022
Quote:
... with a One View Camera (Gatan) at a digital magnification of 59,400 × and a sampling resolution of 2.1 Å per pixel (EM facility ...
-
No products found
because this supplier's products are not listed.
Kevin O. Saunders, et al.,
bioRxiv - Immunology 2020
Quote:
... One-methylpseudouridine (m1Ψ)-5’-triphosphate (TriLink) instead of UTP was used to generate modified nucleoside-containing mRNA ...
-
No products found
because this supplier's products are not listed.
Xibing Xu, et al.,
bioRxiv - Microbiology 2024
Quote:
... Lysis was performed using the One-shot cell disrupter at 1.5 Kbar (One shot model, Constant Systems Ltd). Lysates were centrifuged for 30 min at 30000 x g in 4 °C and the resulting supernatants were gently mixed with Ni-NTA Agarose beads (Qiagen ...
-
No products found
because this supplier's products are not listed.
Maria-Daniela Cirnaru, et al.,
bioRxiv - Neuroscience 2020
Quote:
... using All-in-One qPCR Mix (GeneCopoeia). Quantitative PCR consisted of 40 cycles ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 3’-deoxyadenosine-5’-triphosphate (3’-dATP, Jena Bioscience) at 2 mM and MgCl2 at 4 mM was incubated for 15 minutes at room temperature ...
-
Cat# HY-107826-10 mM * 1 mL,
10 mM * 1 mL, USD $55.0
Ask
Yanli Chang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3mM 3-Methyladenine(3-MA, MedChemExpress, HY-19312) and 80μM dynasore (MedChemExpress,HY-15304) ...
-
No products found
M.Carmen Lafita-Navarro, et al.,
bioRxiv - Molecular Biology 2022
Quote:
ZNF692 sgRNA CRISPR/Cas9 All-in-One Lentivector or Scrambled sgRNA CRISPR/Cas9 All-in-One Lentivector (Applied Biological Materials) was transfected together with lentiviral packaging plasmids pSPAX2 and pMD2g to HEK293FT cells ...
-
No products found
because this supplier's products are not listed.
Hassan Nassour, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The IP-One ELISA assay kit from CisBio Bioassays ...
-
No products found
because this supplier's products are not listed.
Yusaku Koga, et al.,
bioRxiv - Neuroscience 2023
Quote:
... one receiving AMI (10 mg/kg; A0908; TCI) and the other receiving saline as the control by intraperitoneal injection ...
-
No products found
because this supplier's products are not listed.
Truc Do, et al.,
bioRxiv - Microbiology 2019
Quote:
... 0.6% 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Anatrace), 0.5% Triton X-100 reduced ...
-
No products found
because this supplier's products are not listed.
Valentina Casa, et al.,
bioRxiv - Cell Biology 2019
Quote:
... For indicated experiments the One Day ChIP kit (Diagenode) was used according to the protocol of the manufacturer.
-
No products found
because this supplier's products are not listed.
Patrick A. Carroll, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... anti-TXNIP (WB and IF, K0204-3, K0205-3, MBL International), anti-PGK1/2 (WB and IF ...
-
No products found
because this supplier's products are not listed.
Eric E. Irons, et al.,
bioRxiv - Immunology 2019
Quote:
... IL-3 (5ng/ml; BioVision), TPO (25ng/ml ...
-
No products found
because this supplier's products are not listed.
Matvei Khoroshkin, et al.,
bioRxiv - Systems Biology 2023
Quote:
... and end labeled with 3’-Azido-3’-dUTP and IRDye® 800CW DBCO Infrared Dye (LI-COR) on beads ...
-
No products found
because this supplier's products are not listed.
Ya Li, et al.,
bioRxiv - Microbiology 2023
Quote:
... The Escherichia coli strain DH-5α used for routine bacterial transformations (Li et al., 2015) and maintenance of various plasmid vectors was bought from Solarbio Life Sciences ...
-
No products found
because this supplier's products are not listed.
Ding Xiong, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 to 3×106 cells were seeded in one 35mm glass bottom culture dishes (MatTek) after transient transfection ...
-
No products found
because this supplier's products are not listed.
Rosalba Perrone, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... in 3-5% Bovine Serum Albumin - Fraction V in-1X TBS for one hour (Rockland, Baltimore, MD, BSA-1000). Block was removed and slides were incubated in the respective primary antibody diluted in protein block solution for 1 hour or overnight in a humidified chamber ...
-
No products found
because this supplier's products are not listed.
F. Nadalin, et al.,
bioRxiv - Genomics 2023
Quote:
The genomic DNA was extracted from at least one million cells (typically 3 million, coverage 300x) using the NucleoSpin Tissue kit (Macherey-Nagel). To enrich for GBCs ...
-
No products found
because this supplier's products are not listed.
Hui Yan, et al.,
bioRxiv - Immunology 2020
Quote:
... with 100 μg of NP-CGG (in average 16 molecules of NP, 4-hydroxy-3-nitrophenyl acetyl, conjugated to one molecule of CGG, chicken γ-globulin; Biosearch Technologies) in the presence of 100 μl of alum (Imject® Alum adjuvant ...
-
No products found
because this supplier's products are not listed.
Ofer Moldavski, et al.,
bioRxiv - Biochemistry 2020
Quote:
... in Step one Plus (ABI). List of primers is in table 1
-
No products found
because this supplier's products are not listed.
Félix Velando, et al.,
bioRxiv - Microbiology 2024
Quote:
... One-microliter capillary tubes (P1424, Microcaps; Drummond Scientific) were heat-sealed at one end and filled with either the chemotaxis buffer (negative control ...
-
No products found
because this supplier's products are not listed.
Jun Feng, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... and one 3.2 mm stainless steel bead (BioSpec Products). The samples were resuspended in 500 μL of Buffer A (200 mM NaCl (DOT Scientific) ...
-
No products found
because this supplier's products are not listed.
Moritz Gerster, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and segmented “1–3–3–1” electrode DBS-LFP (Abbott St ...
-
No products found
because this supplier's products are not listed.
Kevin J. McNaught, et al.,
bioRxiv - Molecular Biology 2020
Quote:
H3K27me2/3 ChIP using anti-H3K27me2/3 antibody (Active Motif, 39536) was performed as previously described (12 ...
-
No products found
because this supplier's products are not listed.
Michaela Kreitmeier, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... One μg depleted RNA was fragmented (Ultrasonicator system S220, Covaris; 175 W ...
-
No products found
because this supplier's products are not listed.
Javier Ganz, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and one sample with anti-SOX10 (Novus Biologicals, NBP2-59621 AF647) for oligodendrocyte sorting ...
-
5alpha-Cholestan-3-one (Coprostanone) is a substrate of cholestenone 5alpha-reductase.
Cat# S5125, SKU# S5125-25mg,
25mg, $97.00
Ask
Vivek K. Bajpai, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3 μM CHIR99021(Selleck Chemicals) was added ...
-
No products found
because this supplier's products are not listed.
Schechter Meir, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Detection reaction with TMB one component microwell substrate (Southern Biotech, Birmingham, Alabama, USA) – 100 μl well ...
-
No products found
because this supplier's products are not listed.
Brianna E. Alexander, Huaning Zhao, Sophie Astrof,
bioRxiv - Developmental Biology 2023
Quote:
... and Cyanine 3 (Akoya Bioscience, NEL744001KT) according to manufacturer protocols ...
-
No products found
because this supplier's products are not listed.
Safoura Sameni, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Approximately one hundred images were captured on fluorescence microscope (Carl Zeiss Axioplan ǁ, Germany) with triple filters for simultaneous observation of DAPI (blue) ...
-
No products found
because this supplier's products are not listed.
Tori Tonn, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... glass slides (4’’ by 3’’; Ted Pella) and the feature-side of the PDMS slabs were thoroughly cleaned with tape to remove any dust particles ...
-
No products found
because this supplier's products are not listed.
Jingchao Zhang, et al.,
bioRxiv - Microbiology 2021
Quote:
... Then the whole system was sterilized overnight with 3% H2O2 at 3 ml/h using a syringe pump (Harvard Apparatus). After sterilization ...
-
No products found
because this supplier's products are not listed.
Patricia Ho, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3 µL TransIT-LT1 transfection reagent (Mirus Bio) was mixed with 15 µL Opti-MEM (Thermo ...