-
No products found
because this supplier's products are not listed.
A. Perna, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 10 μl of MTT (3 [4,5 dimethylthiazol 2yl] 2,5 di-phenyl-tetrazolium bromide, GoldBio.Com) solution (5 mg/ml ...
-
No products found
because this supplier's products are not listed.
Piyush Daga, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4% (3-Aminopropyl)triethoxysilane(APTES)-treated and 2% glutaraldehyde-activated glass-bottom dishes (Ibidi) were used to cast polyacrylamide (PAA ...
-
No products found
because this supplier's products are not listed.
Nicole Y. Lai, et al.,
bioRxiv - Immunology 2019
Quote:
... NKM-PE (16-2-4) from Miltenyi Biotec, Vγ7-FITC (kindly provided by P ...
-
No products found
because this supplier's products are not listed.
Jérôme Montnach, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Low resistance borosilicate glass pipettes (2-3 MΩ; Sutter Instruments) were filled with a solution containing (in mM) ...
-
Building Block
Sold for research purposes only.
Cat# 1284.0, SKU# 1284-1000 mg,
Inquire
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Anna V. Protasio, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Worms were rinsed in PBS (3×10mins, 3 × 1hr) and equilibriated in mounting media with 4’,6-diamidino-2-phenylindole DAPI (Fluoromount G, Southern Biotech, Birmingham, AL) overnight before mounting and imaging.
-
No products found
because this supplier's products are not listed.
Zhongyun Xie, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the lysate was made from 1∼2 ml packed worms with 3∼4 ml of 0.5-mm diameter glass beads using FastPrep-24 (MP Biomedicals) in lysis buffer [pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Derek Schaeuble, et al.,
bioRxiv - Neuroscience 2023
Quote:
... tissue was blocked again (4% BSA, 3% donkey serum, 0.1% Triton) for 1 hour before incubation in synaptobrevin-2 primary antibody (Synaptic Systems; 104 211C3) (1:200 in blocking solution ...
-
No products found
because this supplier's products are not listed.
Gang Ye, et al.,
bioRxiv - Microbiology 2020
Quote:
Male C57BL/6 mice (3 to 4 weeks old) (Envigo) were intravenously injected (tail-vein ...
-
No products found
because this supplier's products are not listed.
Abbas Jabermoradi, et al.,
bioRxiv - Biophysics 2021
Quote:
... into the back focal plane of the objective lens (OL, CFI Plan Apo Lambda 100x Oil NA 1.45, Nikon). The sample was placed on 3D printed coverslip sample holder and secured in place with small magnets ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Cells were incubated in PBS with 3% donkey serum and the following primary antibodies overnight at 4 °C: rabbit anti-Perilipin 2 (1:200; Proteintech 15294-1-AP), rabbit anti-ACSL1 (1:100 ...
-
No products found
because this supplier's products are not listed.
Michael Jakob Pichler, et al.,
bioRxiv - Microbiology 2020
Quote:
... and sonication bath (3×10 sec at 4°C) (Bioruptor, Diagenode). Lysates were centrifuged (14.000x g ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Charline Ogier, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-TIM3 Ab (4 μg/ml, clone RMT-3-23, BioXCell, Lebanon, NH), or 25-hydroxycholesterol (4 μM ...
-
No products found
because this supplier's products are not listed.
Marija Radosevic, et al.,
bioRxiv - Neuroscience 2019
Quote:
... The slices were incubated for 3 - 4 hr at room temperature with Cyanine-3-conjugated (Cy3) to streptavidin (1:500 or 1:250 Jackson ImmunoResearch labs, Inc) in blocking buffer (PBS with 5% donkey serum and 0.3% Triton X-100) ...
-
No products found
because this supplier's products are not listed.
Christopher D. Greer, et al.,
bioRxiv - Immunology 2021
Quote:
... were coated overnight at 4°C with either 2 ug/ml SARS-CoV-2 Spike Protein ECD (Sino Biological, 40589-V08B1) or 1 ug/ml SARS-CoV-2 Spike-RBD (Sino Biological ...
-
No products found
because this supplier's products are not listed.
Felix Michaud, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Data acquisition (filtered at 2–3 kHz and digitized at 10kHz; Digidata 1440, Molecular Devices, CA, USA) was performed using the Multiclamp 700B amplifier and the Clampex 10.9 software (Molecular Devices) ...
-
No products found
because this supplier's products are not listed.
Swati Dawar, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... incubated for 4 h and fluorescence was read at 550 nm/590 nm on a Cytation 3 Imaging Reader (BioTek).
-
No products found
because this supplier's products are not listed.
Stéphanie Boutet, et al.,
bioRxiv - Plant Biology 2021
Quote:
... an EC 100/2 Nucleoshell Phenyl-Hexyl column (2 x 100 mm, 2.7 μm; Macherey-Nagel) was used for chromatographic separation ...
-
No products found
because this supplier's products are not listed.
Walid Sadok, Remy Schoppach,
bioRxiv - Plant Biology 2019
Quote:
... C613-phenyl-IAA (50 pmol, Cambridge Isotope Laboratories Inc. ...
-
No products found
because this supplier's products are not listed.
Yu-Chia Chen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Samples for Immunostaining were fixed in 2% PFA or 4% 1-ethyl-3 (3-dimethylaminopropyl)-carbodiimide (EDAC, Carbosynth, Berkshire, UK). The fixed brains were dissected to enhance antigen presentation and to improve image quality.
-
No products found
because this supplier's products are not listed.
Tran Thi Nhu Mai, et al.,
bioRxiv - Immunology 2021
Quote:
... and then Phenyl membrane (Sartorius Stedim Biotech, Göttingen, Germany) to remove host cell DNA ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Tori Tonn, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... glass slides (4’’ by 3’’; Ted Pella) and the feature-side of the PDMS slabs were thoroughly cleaned with tape to remove any dust particles ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Hao Li, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3% triton X-100 (4 min, Solarbio, Beijing, China), and goat serum (15 min ...
-
No products found
because this supplier's products are not listed.
Luke A Johnson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... In all patients a directional “1-3-3-1” electrode was used (4/5 patients: Abbott Infinity model 6172 ...
-
No products found
because this supplier's products are not listed.
Rachel Wong, Deepta Bhattacharya,
bioRxiv - Immunology 2020
Quote:
... with 4-hydroxy-3- nitrophenylacetyl-O-succinimide ester (Biosearch Technologies).
-
No products found
because this supplier's products are not listed.
Adam S. Lowet, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and DiD (1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate, Biotium, 60014-10mg) were dissolved in 100% ethanol (Koptec ...
-
No products found
because this supplier's products are not listed.
Simone Franziska Glaser, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Human umbilical vein endothelial cells (HUVECs; passage 2-3) were purchased from PromoCell (#C-12203) and cultured in EBM Medium from Lonza (#CC-3121) ...
-
No products found
because this supplier's products are not listed.
Carlos A. Rodríguez-Salazar, et al.,
bioRxiv - Immunology 2023
Quote:
... an additional wash using NT2 buffer was performed and the beads were incubated with 200 µl of NT2 buffer and treated with 3-[4-(aminosulfonyl) phenyl]propanoic acid (pCEBS) (Enamine US inc.) or 2,5-Dimethyl-4-sulfamoyl furan-3-carboxylic acid (SFC ...
-
3-Methyl-2-buten-1-ol (Prenol, Prenyl alcohol, Dimethylallyl alcohol) is an endogenous metabolite.
Cat# S3123, SKU# S3123-100mg,
100mg, $97.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Christopher D. Greer, et al.,
bioRxiv - Immunology 2021
Quote:
... IL-4 (MABTECH, 3311-4APW-2), and IL-10 (MABTECH ...
-
No products found
because this supplier's products are not listed.
Camille Mazo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... An array of 4 tungsten electrodes (∼3 MΩ; FHC) was glued together and was slowly lowered into the OB ...
-
No products found
because this supplier's products are not listed.
Amada M. Abrego, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Rats were induced with 3-4% isoflurane (SomnoSuite, Kent Scientific) and all whiskers on the right facial pad were trimmed except B1 ...
-
No products found
because this supplier's products are not listed.
Yeon Soo Kim, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
No products found
because this supplier's products are not listed.
Ana S Almeida, et al.,
bioRxiv - Microbiology 2021
Quote:
... and three 3–4 mm sterile glass beads (Biospec Products). Next ...
-
No products found
because this supplier's products are not listed.
Sergio Galindo-Trigo, et al.,
bioRxiv - Genetics 2019
Quote:
... Immunoprecipitations were performed in the same buffer with 0.5% IGEPAL for 3-4 hours at 4 °C with GFP-trap resin (Chromotek). Beads were washed 3 times with the same buffer and bound proteins were eluted by addition of SDS loading dye and heating to 90°C for 10 min ...
-
No products found
because this supplier's products are not listed.
S.M. Kamel, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Pipettes (resistance 3–4 MΩ) were pulled from borosilicate glass capillaries (Harvard Apparatus, UK) using a custom-made microelectrode puller ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Natalia Benetti, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 3 and 4 by lysing cells in the 6-well plate in RNA lysis buffer (Zymo) and freezing at −80 °C until extraction ...
-
No products found
because this supplier's products are not listed.
S. P. Maher, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vivax cases were infected into PHH lot BGW at day 2 post-seed (for case 1) or day 3 post-seed (for cases 2 and 3) in 384-well plates (Greiner Bio-One cat 781956) using the same methods for initiating P ...
-
No products found
because this supplier's products are not listed.
Esmi Lau Zajaczkowski, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
No products found
because this supplier's products are not listed.
HJ Monzo, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... sections were blocked with 3% BSA in PBS for 30 min and incubated with SSEA-4 antibody (GTX48037, Genetex) overnight ...
-
No products found
because this supplier's products are not listed.
Nicolas Daviaud, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Slides were then incubated overnight at 4°C with the following primary antibodies diluted in blocking solution: rabbit anti-cleaved caspase 3 (1:200, Novus Biologicals), rat anti-CTIP2 (1:500 ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Wei Liu, et al.,
bioRxiv - Bioengineering 2022
Quote:
Transfection of human pancreatic MIA PaCa-2 and BxPC-3 cells was performed with TransIT-mRNA (Mirus Bio) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Andrés López-Perrote, et al.,
bioRxiv - Biophysics 2020
Quote:
... Inputs (2 μl) and elutions (10 μl) samples were analyzed by 4-15% SDS-PAGE (MINI-PROTEAN TGX stain-free, Bio-Rad) and staining with Quick Coomassie (Generon ...