-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2-heptylquinolin-4(1H)-one (HHQ, Ark Pharm); 2-heptyl-4-hydroxyquinoline N-oxide (HQNO ...
-
No products found
because this supplier's products are not listed.
Caitlin L. Maikawa, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 4-((((2-carboxyethyl)thio)carbonothioyl)thio)-4-cyanopentanoic acid (BM1433; Boron Molecular, >95%) were used as received ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
MaryAnn Martin, Irene L.G. Newton,
bioRxiv - Microbiology 2023
Quote:
... Eluted fractions were run 1-2 centimeters into a 4-20% PAGE minigel (NuSep) and the wedge of gel cut out from dye front to wells was submitted for analysis to the Indiana University Laboratory for Biological Mass Spectrometry ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Gokhan Unlu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5 x105 cells were placed in a microfuge tube and incubated with 2 μM ZnMP (Frontier Scientific) in 1x HBSS for 15 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Yu-Ling Lin, et al.,
bioRxiv - Neuroscience 2022
Quote:
Mice were deeply anesthetized with isoflurane (4% induction, 1.5%–2% maintenance in O2; Halocarbon Laboratories, North Augusta, SC, USA) and placed in a stereotaxic injection frame (IVM-3000 ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Julio C.Y. Liu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... ML-792 (SUMOi; 2 μM, MedKoo Biosciences), MLN-7243 (Ub-E1i ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... or 4-dimethylaminophenylazophenyl-4’-maleimide (DABMI, Setareh Biotech). After labeling ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Diego A. Vargas-Blanco, et al.,
bioRxiv - Microbiology 2019
Quote:
... transferred to 2 mL disruption tubes (OPS Diagnostics 100 μm zirconium lysing matrix ...
-
No products found
because this supplier's products are not listed.
Alec T Beeve, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and the implant site muscle and skin layers were closed with 5-O Vicryl (Ethicon, J303H) and 4-O Nylon (McKesson, REF S662GX) suture ...
-
No products found
because this supplier's products are not listed.
An Phu Tran Nguyen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... sections were pre-incubated in 4% PFA (in 0.1 M PB) for ≥2 days at 4°C before processing with the FD NeuroSilver™ kit II (FD Neurotechnologies, Inc.) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Lara N. Janiszewski, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Media with essentially no Zn was made by adding 3 µM 2-{[Bis(2-pyridinylmethyl)amino]ethylamino}benzenesulfonic (ZX1, an extracellular Zn chelator(61)) (Strem Chemicals, Inc.) to Chelex media ...
-
No products found
because this supplier's products are not listed.
M. Tomasi, et al.,
bioRxiv - Microbiology 2021
Quote:
... 1-2×106 cells from lamina propria and tumors were incubated with 5 μl of OVA257-264 Dextramer-PE (SIINFEKL, IMMUDEX, Virum Denmark) for 10 minutes at room temperature in a 96-well plate ...
-
No products found
because this supplier's products are not listed.
Jérôme Cattin-Ortolá, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5% FBS (RMBIO), and 1X Pen/Strep (GIBCO ...
-
No products found
because this supplier's products are not listed.
Kyle Vaccaro, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Cells were blocked with 100 ug/mL mouse IgG (Lampire Biological Laboratories) or Human TruStain FcX (BioLegend) ...
-
No products found
because this supplier's products are not listed.
Laurence Abrami, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2-Bromopalmitate (2-BP; Focus Biomolecules, FBM-10-3284) at 100 μM at 37°C during the indicated time.
-
No products found
because this supplier's products are not listed.
Maud de Dieuleveult, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and TET2 (R1086-4; Abiocode). The immunoprecipitated complexes were eluted in Laemmli buffer.
-
No products found
because this supplier's products are not listed.
Geoffrey L. Rogers, et al.,
bioRxiv - Immunology 2023
Quote:
... Plates were coated with either 5 µg/mL JR-CSF gp120 (Immune Technology) in coating buffer for samples ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Maria E. Candela, et al.,
bioRxiv - Immunology 2021
Quote:
Treatments with HBD3 peptide(s) was after 15-30 minutes 5 μg/ml of human β-Defensin-3 (hBD3) (Peptide Institute Inc., PeptaNova GmbH #4382-s), or 5 μg/ml of Linear Defensin (Almac Sciences Scotland Ltd ...
-
No products found
because this supplier's products are not listed.
Jingyou Yu, et al.,
bioRxiv - Microbiology 2021
Quote:
... The plates were washed with ELISPOT wash buffer (11% 10x DPBS and 0.3% Tween20 in 1L MilliQ water) and incubated for 2 h with Rabbit polyclonal anti-human IFN-γ Biotin from U-Cytech (1 µg/mL). The plates were washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase from Southern Biotech (2 µg/mL) ...
-
3′, 5′-Dimethoxy-4′-hydroxyacetophenone is a small molecule.
Cat# abx082212-1G,
1 g USD $261.0
Ask
Michaela Frolikova, et al.,
bioRxiv - Cell Biology 2023
Quote:
... diluted 1:50 in 1% BSA in PBS and rabbit polyclonal anti-Folate receptor 4 (Juno) (abx102438, Abbexa, UK) diluted 1:50 in 1% BSA in PBS followed by 1 hr ...
-
No products found
because this supplier's products are not listed.
David S. Milner, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 2 Bacteriological (Neogen)] or Scm-his agar (containing CSM-histidine in place of CSM-uracil) ...
-
No products found
because this supplier's products are not listed.
Alasdair TM Hubbard, et al.,
bioRxiv - Microbiology 2019
Quote:
... at 5 × 105 cells per ml in CnT-Prime medium (CnT-PR, CELLnTEC, Switzerland). An appropriate amount of CnT-PR was added to the basolateral chamber of the inserts so that the medium levels were equal ...
-
No products found
because this supplier's products are not listed.
Nick Quinn-Bohmann, et al.,
bioRxiv - Systems Biology 2023
Quote:
Fecal samples were collected in 1200 mL 2-piece specimen collectors (Medline, USA) in the Public Health Science Division of the Fred Hutchinson Cancer Center (IRB Protocol number 10961 ...
-
Mouse monoclonal antibody specific for Canine Distemper surface envelope antigen (5-4)
Cat# MAB12407-100,
100µg USD $305.35
Ask
Malcolm Turk Hsern Tan, et al.,
bioRxiv - Microbiology 2020
Quote:
... NoV GII.4 VLPs (1.1 mg/ml, purity greater than 95%, The Native Antigen Company, UK) were pre-incubated with the fucoidan (from Fucus vesiculosus ...
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Yiyao Huang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... from 5 ml to 0.5 ml before application onto qEV Original SEC columns (IZON Science SP1-USD, Christchurch, New Zealand) that had been pre-rinsed with 15 ml PBS ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Dongjin S Shin, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Briefly, 20 mL of light mineral oil (O121-4, Fisher) was placed in a 100 mL microcarrier spinner flask (Bellco Glass Inc.) located in a preheated in water bath (37 °C) ...
-
No products found
because this supplier's products are not listed.
Travis B. Kinder, et al.,
bioRxiv - Immunology 2020
Quote:
... IFN-β titration in Figure 2 was dispensed at 50 nl/well with a Mosquito (TTP Labtech, Boston, MA). Refer to supplemental materials and methods for detailed protocol tables as we have described previously (Inglese et al. ...
-
No products found
because this supplier's products are not listed.
Derin Sevenler, Mehmet Toner,
bioRxiv - Bioengineering 2023
Quote:
Stock solutions of 4 mg/mL HA were typically prepared by dissolving 1.6 MDa sodium hyaluronate (HA15, Lifecore Biomedical) in phosphate buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Guy Schleyer, et al.,
bioRxiv - Microbiology 2022
Quote:
... The upper organic phase (1.5 mL) was transferred to 2 mL centrifuge tubes and dried under a flow of nitrogen (TurboVap LV, Biotage, Uppsala, Sweden). The polar phase was re-extracted with 1.5 mL of MTBE ...
-
No products found
because this supplier's products are not listed.
Nadezhda Y. Davydova, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The HLM sample refered here as HLM-2 is an InVitroCYP™ M-class 50-donor mixed gender pooled HLM preparation (lot LFJ) obtained from BioIVT corporation (Baltimore ...
-
No products found
because this supplier's products are not listed.
Alfa Herrera, et al.,
bioRxiv - Microbiology 2019
Quote:
... The cells were then washed with PBS and incubated with 5 µg/mL Hoescht 33342 (Immunochemistry Technologies 639) in PBS ...
-
No products found
because this supplier's products are not listed.
Mallory Paynich Murray, et al.,
bioRxiv - Immunology 2021
Quote:
... Homogenates were inoculated at different dilutions in a volume of 50 μl on 5% sheep blood agar plates (Hardy Diagnostics, Santa Maria, CA) and cultured for 18 h ...
-
No products found
because this supplier's products are not listed.
Maria L. Sorkin, et al.,
bioRxiv - Plant Biology 2022
Quote:
... and 5 μM MG132 (Peptides International, Louisville, KY)) and sonicated using a duty cycle of 20 s (2 s on ...
-
No products found
because this supplier's products are not listed.
Kristina D. Micheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The pellet was then washed twice for 5 min each in a solution of 3 parts LR White acrylic resin (hard grade, SPI supplies Cat# 2645) and 1 part 70% ethanol ...
-
No products found
because this supplier's products are not listed.
Rebecca O’Cleirigh, Roslyn Gibbs,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... containing 5% (v/v) FCS and incubated overnight in a humidified atmosphere at 37°C and 5% CO2 (Nuaire, DH Autoflow). After 24 hours 1.5mL of the media was removed and media with herb extract or media only control was added ...
-
No products found
because this supplier's products are not listed.
Franziska Herster, et al.,
bioRxiv - Immunology 2019
Quote:
... 4 μg/g of anti-CD42b (clone R300, Emfret Analytics) or rat IgG isotype control (clone R301 ...
-
No products found
because this supplier's products are not listed.
Constanza Ahumada-Marchant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 500 mM NaCl and 2 mM MgCl2 pH 8.0) containing 100U/mL of Salt Active Nuclease (Arcticzymes, USA) and incubated at 37°C for 1 hour ...
-
No products found
because this supplier's products are not listed.
Alexandra Q Bartlett, et al.,
bioRxiv - Physiology 2021
Quote:
... Primary antibodies used were: Ki67 (Neomarkers RM-9106-s, 1:50) for 2 hours at RT and Adipophilin (LS-B2168/34250 Lifespan Biosciences, 1:400) for 1 hour at RT ...
-
No products found
because this supplier's products are not listed.
Jasper T. Maniates-Selvin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and diamond knife (4 mm, 35° Ultra or Ultra-Maxi, Diatome) were used to cut ultra-thin serial sections (∼45 nm ...
-
No products found
because this supplier's products are not listed.
Wentao Yu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... An optical long-pass filter can be placed before the tube lens to further reduce the backscattered UV light. A custom-built 2-axis angle adjustable platform (Supplementary Fig. 2) under the vibratome (VF-700-0Z, Precisionary Instruments Inc.) ensures the focal plane of the objective lens is parallel with the surface of the sample sectioned by the vibratome ...
-
No products found
because this supplier's products are not listed.
Aaron J Farrugia, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Reverse transcription was performed using Precision NanoScript 2 Reverse-Transcription-kit (PrimerDesign) and qPCR using PrecisionPLUS 2x qPCR MasterMix with ROX and SybrGreen (PrimerDesign) ...