-
No products found
because this supplier's products are not listed.
Yeuklan Poon, Mamie Hui,
bioRxiv - Microbiology 2022
Quote:
... 100 μl of 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide (XTT, 0.5 mg/ml in PBS, Sigma-Aldrich, USA) with 1 μM of menadione (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Francis Ledesma, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171; Tocris, 1018830-99-3), 5-[2-(5-nitro-2-furanyl)ethenyl]-2-furancarboxylic acid ...
-
No products found
because this supplier's products are not listed.
Christof Gaunt, et al.,
bioRxiv - Immunology 2021
Quote:
... anti-IL-4 antibody (2 ug/ml; clone MD-1, Biolegend), bexarotene (1 μM ...
-
No products found
because this supplier's products are not listed.
Antonia C. Darragh, Scott A. Rifkin,
bioRxiv - Evolutionary Biology 2022
Quote:
... Embryos were then washed with wash buffer and their nuclei stained with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole, Roche) prepared in wash buffer for 10 minutes at 30 ºC.
-
No products found
because this supplier's products are not listed.
Mélanie Rogier, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-4 (5 ng/ml; Peprotech) and an anti-CD40 antibody (200 ng/ml ...
-
No products found
because this supplier's products are not listed.
Annamarie E. Allen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were incubated in treatment media for the indicated period of time and then MTS reagent ((3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) purchased from Abcam, (ab197010 ...
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
No products found
because this supplier's products are not listed.
Joshua D. Kerkaert, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 300μL of XTT solution was added to each well (0.5mg/mL XTT [2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide] (VWR) with 25μM menadione in PBS) ...
-
No products found
because this supplier's products are not listed.
Eszter Somogyi, et al.,
bioRxiv - Immunology 2020
Quote:
... the media were refreshed and supplemented with 5 ng/mL IL-7 or 5 ng/mL IL-7 and 4 ng/ml IL-2 (R&D Systems), respectively ...
-
No products found
because this supplier's products are not listed.
Pattama Wiriyasermkul, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 50 μL of 1 mg/mL XTT (2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide) (Biotium) was mixed with 5 μL of 1.5 mg/mL phenazine methosulfate ...
-
No products found
because this supplier's products are not listed.
Maali AlAhmad, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
No products found
because this supplier's products are not listed.
EL Castranio, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 50% 5 μM methoxy-XO4 (Cayman Chemical) in 50% EtOH for 2 minutes ...
-
No products found
because this supplier's products are not listed.
Suhas Sureshchandra, et al.,
bioRxiv - Immunology 2022
Quote:
... 2 ug/mL Pam3CSK4 (TLR1/2 agonist, Invivogen), and 1 ug/mL FSL-1 (TLR2/6 agonist ...
-
No products found
because this supplier's products are not listed.
Konstadinos Moissoglu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Mareike D. Hoffmann, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB), followed by denaturation and re-annealing in a nexus GSX1 Mastercycler (Eppendorf ...
-
No products found
because this supplier's products are not listed.
Doyoung Kwon, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ...
-
No products found
because this supplier's products are not listed.
Sora Kim, et al.,
bioRxiv - Biophysics 2022
Quote:
... were mixed in 70 μL of assembly buffer (50 mM HEPES-KOH, pH 7.5, 300 mM KCl, 5 mM MgCl2, 2 mM TCEP, 4% glycerol, 2 mM ATPγS [Calbiochem]) for 5 min at 25 °C ...
-
No products found
because this supplier's products are not listed.
Dougald M. Monroe, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4 μM lipid vesicles (Avanti Polar Lipids PS:PC:PE 3:2:5), and FV (0 ...
-
No products found
because this supplier's products are not listed.
Hsiao-Wei Tsao, et al.,
bioRxiv - Immunology 2021
Quote:
... 50 U/ml Penicillin and 50 ug/ml Streptomycin) supplemented with 100 U/ml hIL-2 and 2 ug/ml anti-CD28 (BD Pharmingen, 553294). Two days after the primary stimulation ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biochemistry 2022
Quote:
... #DF0446-07-5) or 7H10 (Difco, cat# DF0627-17-4) plates containing 50 ug/mL hygromycin (GoldBio, cat. #H-270) and incubated at 37° C for 3-5 days ...
-
No products found
because this supplier's products are not listed.
Shigeki Nanjo, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Equal masses of protein (5 ug – 40 ug) were separated by 4—15% of SDS/ PAGE and were transferred onto nitrocellulose membranes (Bio-Rad) for protein blot analysis ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
Pericytes viability was assessed using the 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assay according to the manufacturer’s procedure (Cell Signaling Technology). Cells were plated at the appropriate concentration in 96-well plates under different experimental conditions ...
-
No products found
because this supplier's products are not listed.
Rohan Kodgule, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and rotated at 4°C overnight with 2-5 ug of antibody (H3K27ac, Active Motif Cat #39133; V5 tag, ThermoFisher #R960-25; ETV6, Santa Cruz, # sc-166835x ...
-
No products found
because this supplier's products are not listed.
Sebastian Ströh, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA)
-
No products found
because this supplier's products are not listed.
Rosa L. Vincent, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 5% Human AB serum (Gemini) supplemented with 50 units/mL IL-2 every 2 days for all experiments (Miltenyi Biotec).
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Ying-Chao Hsueh, et al.,
bioRxiv - Immunology 2022
Quote:
... 5 ug/ml Brefeldin A was supplemented 4 hrs before subsequent Fc blocking (2.4G2, BioXCell), surface antibody staining ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
David J. Levy-Booth, et al.,
bioRxiv - Microbiology 2019
Quote:
... 4-propylphenol (>99%, TCI), 3,4-dimethylphenol (DMP ...
-
No products found
because this supplier's products are not listed.
Ali Akbar Karkhaneh Yousefi, et al.,
bioRxiv - Biophysics 2023
Quote:
... and in 5 mL culture medium (SmGM-2, Lonza) at last ...
-
No products found
because this supplier's products are not listed.
Lixia Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 4 μM oligomycin and 50 mM 2-DG (Agilent, Cat# 103020-100).
-
No products found
because this supplier's products are not listed.
Rohan Kodgule, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and rotated at 4°C overnight with 2-5 ug of antibody (H3K27ac, Active Motif Cat #39133 ...
-
Prepared to contain higher collagenase and caseinase activities. A dialyzed, lyophilized powder.
Cat# LS005282,
1 gm, $246.00
Ask
Muhammad Saad Yousuf, et al.,
bioRxiv - Neuroscience 2023
Quote:
... These chunks were immersed in 5 ml of pre-warmed enzyme solution (2 mg/mL STEMzyme I, 4 µg/mL DNAse I obtained from Worthington Biochemical #LS004107 and #LS002139) in Hanks’ Balanced Salt Solution (HBSS ...
-
No products found
because this supplier's products are not listed.
Han Zhu, et al.,
bioRxiv - Cell Biology 2022
Quote:
Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Matheus Silvério Mattos, et al.,
bioRxiv - Immunology 2023
Quote:
... A 5 ml protein G Sepharose 4 Fast flow column (GE Healthcare) was used to extract total human IgG ...
-
No products found
because this supplier's products are not listed.
Sonja Kersten, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 300 mg of plant material was collected into a 2 ml screw cap tube filled with 4-5 porcelain beads and ground with a FastPrep tissue disruptor (MP Biomedicals). For DNA extraction ...
-
No products found
because this supplier's products are not listed.
Jessica D. Resnick, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 4 ug/mL Heparin sodium salt in PBS (StemCell Technologies) was replaced on the basolateral side only ...
-
No products found
because this supplier's products are not listed.
Dillon S. McDevitt, et al.,
bioRxiv - Neuroscience 2019
Quote:
... recording electrodes (2-5 MΩ; borosilicate glass capillaries (WPI #1B150F-4) pulled on a horizontal puller from Sutter Instruments (model P-97) ...
-
No products found
because this supplier's products are not listed.
Niccolò Paolo Pampaloni, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Slices were superfused with recirculating aCSF (5 mL/min at room temperature) containing 4-methoxy-7-nitroindolinyl-glutamate (MNI-caged-L-Glutamate; HelloBio HB0423) at a concentration of 0.5 mM and used for the whole day of recordings.
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Marcel-Joseph Yared, et al.,
bioRxiv - Biochemistry 2022
Quote:
... then 5 mL Optiphase ‘HISAFE’ 2 scintillation cocktail (PerkinElmer) were added ...
-
No products found
because this supplier's products are not listed.
Paul Renauer, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 4 x 2 mm (Phenomenex). The eluents were A ...
-
No products found
because this supplier's products are not listed.
Christopher P. Knapp, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
... Animals were obtained at either 3-4 weeks old/50-75g (behavioral experiments) and 5-6 weeks old/100-125g (Western blotting experiments) from Charles River Laboratories and housed in a 12h:12h reverse light/dark cycle facility ...
-
No products found
because this supplier's products are not listed.
Yoko Hayashi-Takanaka, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and centrifuged at 40,000 rpm (∼128,000 × g) for 3 h at 4°C using an MLS-5 rotor (Beckman Coulter). Aldolase (158 kDa ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
Cat# HY-W008378-10 mM * 1 mL,
10 mM * 1 mL, USD $55.0
Ask
Guohui Zhang, et al.,
bioRxiv - Biophysics 2022
Quote:
BC5 (ARG-4-Methoxy-2-Naphthylamine, ordered from Medchemexpress LLC Monmouth Junction, NJ) was dissolved into DMSO to make 100 mM stock solution and then added to recording solutions to the final concentrations ...
-
No products found
because this supplier's products are not listed.
Christopher D. Greer, et al.,
bioRxiv - Immunology 2021
Quote:
... were coated overnight at 4°C with either 2 ug/ml SARS-CoV-2 Spike Protein ECD (Sino Biological, 40589-V08B1) or 1 ug/ml SARS-CoV-2 Spike-RBD (Sino Biological ...