-
No products found
because this supplier's products are not listed.
Frank Hidalgo, et al.,
bioRxiv - Biophysics 2022
Quote:
... Peptides were desalted for 4 minutes on a trap column (1 mM ID x 2 cm, IDEX C-128) manually packed with POROS R2 reversed-phase resin (Thermo Scientific 1112906) ...
-
No products found
because this supplier's products are not listed.
Tristan Lerbs, et al.,
bioRxiv - Immunology 2020
Quote:
We used a One Step Trichrome Stain Kit (American MasterTech). After deparaffinization and rehydration ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 4: (S)-2-amino-6-((2-azidoethoxy)carbonylamino)hexanoic acid (LysN3, Iris Biotech GmBH); 5 ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 4 µg Cx36 and 4 µg V5-dGBP-TurboID using 50 µl Geneporter 2 (Genlantis). 24 h after transfection HEK293T cells were treated with 50 µM Biotin in 10% DMEM for 3 h to induce biotinylation of proximal proteins ...
-
No products found
because this supplier's products are not listed.
Jun Li, et al.,
bioRxiv - Bioengineering 2023
Quote:
YS5 was first conjugated with the bi-functional chelator 2-(4-isothiocyanotobenzyl)-1,4,7,10-tetraaza-1,4,7,10-tetra-(2-carbamoylmethyl)-cyclododecane (TCMC; Macrocyclics, Plano, TX) at the molar ratio of TCMC/YS5 at 10:1 ...
-
No products found
because this supplier's products are not listed.
Shila Gurung, et al.,
bioRxiv - Biophysics 2019
Quote:
... Similarly cholic acid (2, 4-3H) was obtained from American Radiolabeled Chemicals, Inc ...
-
WB, IHC,ELISA
Cat# A5444, SKU# A5444-20ul,
20ul, $47.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Hillary A. Wadsworth, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 5-(3-Bromophenyl)-1,3-dihydro-2H-benzofuro[3,2-e]-1,4-diazepin-2-one (5-BDBD) (cat. no. T22518, TargetMol, Wellesley Hills, Massachusetts, USA) were dissolved in stock solutions and then diluted into ACSF at specified concentrations (50 µM IVM ...
-
No products found
because this supplier's products are not listed.
Minal Engavale, et al.,
bioRxiv - Immunology 2023
Quote:
... Portions of the blot were incubated with one of the following primary antibodies for 2 hours at room temperature or overnight: anti-human Dnase1L3 (1:1000) (Abnova and Genetex), pre-immune rabbit serum (1:5000) ...
-
No products found
because this supplier's products are not listed.
Raphael A. Reyes, et al.,
bioRxiv - Immunology 2024
Quote:
... One hundred fifty µL blocking buffer (one-third Non-Animal Protein (NAP)-Blocker (G-Biosciences #786-190P) and two-thirds PBS ...
-
No products found
because this supplier's products are not listed.
Hyuntae Jeong, et al.,
bioRxiv - Biophysics 2023
Quote:
... the polymerized PA gel was treated with sulfosuccinimidyl-6-(4-azido-2-nitrophenylamino) hexanoate (Sulfo-SANPAH; Proteochem) 1 mg/ml in 50 mM HEPES buffer (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Ophir Vermesh, et al.,
bioRxiv - Bioengineering 2021
Quote:
Six one-liter chambers (Braintree Scientific, Braintree, MA) were operated in parallel for simultaneous mouse limonene measurements (Fig ...
-
No products found
because this supplier's products are not listed.
Flavio R. Palma, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... for 2 h at 4 °C and finally stained with anti-8-oxo-dG (Trevigen, #4354-MC-050), followed by incubation with secondary antibody Alexa647 (Invitrogen #A28181) ...
-
No products found
because this supplier's products are not listed.
Seong-Beom Park, et al.,
bioRxiv - Neuroscience 2021
Quote:
... dehydrated using an ethanol series (50%, 4 min; 75%, 4 min; 95%, 4 min; 100%, 4 × 4 min) and cleared with Histoclear II (National Diagnostics, Atlanta, GA, USA) (3 × 4 min) ...
-
No products found
because this supplier's products are not listed.
Meghal Desai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Lysates clarified by centrifugation at 10,000g for 15 minutes at 4°C were incubated with 5ul of serum containing antibodies for 2 hours at 4°C followed by the addition of pre-blocked (with 1% BSA) Protein-A beads (Repligen) for an additional 2 hours ...
-
No products found
because this supplier's products are not listed.
Maxence LANOIZELET, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (1) 2 hrs at RT or O/N at 4°C in 75 µg/ml of CBM3a-GFP (CZ00571, Nzytech), (2 ...
-
No products found
because this supplier's products are not listed.
Maria del Mar Aguilo-Ferretjans, et al.,
bioRxiv - Microbiology 2020
Quote:
... one-way stopcock valves (WZ-30600-00; Cole-Parmer, USA), and Luer connectors ...
-
No products found
because this supplier's products are not listed.
Qixiang He, et al.,
bioRxiv - Biochemistry 2021
Quote:
One or two liters of Trichoplusia (Tni) cells (Expression System) were infected with recombinant baculoviruses at a cell density of 1.5-2.0 × 106 cells per mL ...
-
No products found
because this supplier's products are not listed.
Peter Koppensteiner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... in 2% BSA in TBS at 4 °C for 2 O/N and respective 1.4 nm gold-conjugated secondary antibodies (Nanoprobes Inc., USA) for silver intensification or in biotinylated anti-rabbit secondary antibody (Vector Labs ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Seiya Yamada, et al.,
bioRxiv - Neuroscience 2021
Quote:
... were blocked for 2 h at 4°C with 5% normal goat serum in PBST and incubated with anti-EGFP (1:2000, Aves Labs, GFP-1010), anti-HA (1:500 ...
-
No products found
because this supplier's products are not listed.
Koji Ohira, et al.,
bioRxiv - Neuroscience 2019
Quote:
... One group was treated with FLX pellets (Innovative Research of America, Sarasota, FL) for 4 weeks at a dose of 3 mg/kg/day ...
-
No products found
because this supplier's products are not listed.
Carlos A. Elena-Real, et al.,
bioRxiv - Biophysics 2022
Quote:
... 150 mM NaCl) at 4°C using SpectraPor 4 MWCO 12-14 kDa dialysis tubing (Spectrum Labs). Dialyzed protein was then concentrated with 10 kDa MWCO Vivaspin centrifugal concentrators (3,500 xg ...
-
No products found
because this supplier's products are not listed.
Ariane Zutz, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The isolated fractions were separated on SDS-PAGE (RunBlue 4-20 %, Expedeon; NuPAGE®Bis-Tris gel 4-12%, Invitrogen) and analysed by InstantBlue staining (Expedeon ...
-
No products found
because this supplier's products are not listed.
Vanessa R Povolo, et al.,
bioRxiv - Microbiology 2022
Quote:
... and xylan (2% w/v, Megazyme) were prepared with nanopure water and filter sterilized using 0.4 μm surfactant-free cellulose acetate filters (Corning) ...
-
No products found
because this supplier's products are not listed.
Shahanshah Khan, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 M (MyBioSource, MBS8574735) and SARS-CoV-2 E (MyBioSource ...
-
No products found
because this supplier's products are not listed.
Kenneth H. Risner, et al.,
bioRxiv - Microbiology 2022
Quote:
... SARS-CoV-2 Spike Antibody (ProSci, 3525) was also used to detect expressed S-protein ...
-
Creatinine Serum assay Kit
Cat# KB02-H2,
1.0 ea, USD $385.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Mathieu Paquette, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... cells were incubated for 2 h in medium containing one of the following reagents: Dimethyl sulfoxide (DMSO) (0.1%) (Bioshop Canada, DMS666), Torin1 (1 μM ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
LC Laboratories' Product Number L-7962 - LY 294002, Free Base...
Cat# L-7962, SKU# L-7962_50mg,
50 mg, $40.00
Ask
Josh Tycko, et al.,
bioRxiv - Systems Biology 2023
Quote:
... in one well 100 nM Rapamycin (LC Laboratories) was added and the other well contained regular RPMI complete media ...
-
No products found
because this supplier's products are not listed.
Kavya Prasad, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... mounted in Vectashield Antifade solution (4’,6 diamidino-2-phenylindole, Vector laboratories H-1200, Axxora/Alexis, Lörrach, Germany) with DAPI and cover with 24×60 mm coverslip sealed with a nail polish ...
-
No products found
because this supplier's products are not listed.
Maxime Mivelaz, et al.,
bioRxiv - Biophysics 2019
Quote:
... Flow-chambers were assembled from one glass slide and one coverslip separated by double-sided 0.12 mm tape (Grace Bio-labs) positioned between each hole in the glass slide ...
-
No products found
because this supplier's products are not listed.
Dhananjay M. Nawandar, et al.,
bioRxiv - Microbiology 2022
Quote:
... One or two drops of 0.5% proparacaine (McKesson Corp.) were applied to the eye ...
-
No products found
because this supplier's products are not listed.
Mark K. Adams, et al.,
bioRxiv - Systems Biology 2019
Quote:
... One mL of FBS (Peak Serum, Inc, Wellington CO) was added the next morning ...
-
No products found
because this supplier's products are not listed.
Ludovic Spaeth, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 4% for induction then 1-2% for the surgery) and mounted on a stereotaxic frame (Model 68526, RWD Life Science). Body temperature was monitored using a rectal probe and maintained with a heat pad ...
-
No products found
because this supplier's products are not listed.
Govind Nair, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and spun down for one minute (MyFuge C1012, Benchmark Scientific). Samples in 8-well tubes were heat-shocked for three minutes at 72 °C (C1000 Touch Thermal Cycler ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated overnight with anti-IgG1 or anti-IgG4 (2 µg/ml clones MH161-1, MH161-1, MH164-4 respectively, Sanquin Reagents) in PBS ...
-
No products found
because this supplier's products are not listed.
Austin T. Baldwin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
No products found
because this supplier's products are not listed.
Gloria Somalo-Barranco, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... and automated with Isolera™ One with UV-Vis detection (Biotage).
-
No products found
because this supplier's products are not listed.
Jennifer M. Achiro, et al.,
bioRxiv - Neuroscience 2023
Quote:
... one hippocampus was homogenized with a Dounce tissue grinder (Wheaton 357544) in 2 mL HB buffer (1 mM DTT ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 2: 2-Amino-6-(prop-2-ynoxycarbonylamino)hexanoic acid (LysAlk, AstaTech); 3 ...
-
No products found
because this supplier's products are not listed.
Xing Fang, et al.,
bioRxiv - Neuroscience 2022
Quote:
Cell contractile capabilities were compared using primary cerebral VSMCs (passages 2 – 4) with a collagen gel-based cell contraction assay kit (CBA-201, Cell Biolabs, San Diego, CA) following our optimized protocol 9,40,48,53,57,58 ...
-
No products found
because this supplier's products are not listed.
Shao-Jung Hsu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... one given adeno-associated virus (AAV)8-mouseVEGF-C (Vector Biolabs, Malvern, PA) and the other given AAV8-GFP (control ...
-
No products found
because this supplier's products are not listed.
Luca Tadini, et al.,
bioRxiv - Plant Biology 2019
Quote:
... AtHsc70-4 antibody from Antibodies-online, RpoTp (PHY0835S ...
-
No products found
because this supplier's products are not listed.
Augusto Cesar Hunt-Serracin, et al.,
bioRxiv - Microbiology 2019
Quote:
... 4 g of Deoxyribonucleic Acid (Spectrum Chemicals), 5.9 mg diethylene triamine pentaacetic acid (DTPA) ...
-
No products found
because this supplier's products are not listed.
Ali Mohebi, Karim G. Oweiss,
bioRxiv - Neuroscience 2020
Quote:
... The dummy cannula was removed and replaced on one side with an injector (Hamilton Company, Nevada, USA) the end of which extended 0.5 mm from the tip of the guide cannula ...
-
No products found
because this supplier's products are not listed.
Shaohe Wang, Kazue Matsumoto, Kenneth M. Yamada,
bioRxiv - Developmental Biology 2020
Quote:
... 4 mL 5× PEG reagent (System Biosciences, LV825A-1) was added and mixed by pipetting ...
-
No products found
because this supplier's products are not listed.
Mansi Prakash, et al.,
bioRxiv - Neuroscience 2021
Quote:
... containing 2 mg/ml papain (BrainBits). Papain solution was removed ...