-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Jordan A Bairos, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Low-density lipoprotein (LDL) and acetylated LDL (acLDL) was from Kalen Biomedical (catalog #770200-8 and #770201-4). Hoechst 33342 (catalog #62249) ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Lars Emil Larsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using a 5 µL Hamilton Neuros Syringe (33 gauge, point style 3, Hamilton company, USA) and a Quintessential Stereotaxic Injection System (Stoelting ...
-
No products found
because this supplier's products are not listed.
Laura M. Canaday, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IL-8) (Meso Scale Discovery) and the DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA (PBL Assay Science) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... Specific proteins were detected using rabbit anti-VP8* P[8]/P[4] or P[6] polyclonal antibodies (1:1,000; generated in this study by Aldevron Freiburg GmbH), guinea pig anti-LS-P2-VP8* P[8] polyclonal antiserum (1:500 ...
-
No products found
because this supplier's products are not listed.
Jennifer V. Gerbracht, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-CASC3 amino acid residues 367-470 (Atlas Antibodies, #HPA024592), anti-EIF4A3 (Genscript) ...
-
No products found
because this supplier's products are not listed.
Niek Andresen, et al.,
bioRxiv - Animal Behavior and Cognition 2019
Quote:
... The cages contained fine wooden bedding material (LIGNOCEL® 3–4 S, J. Rettenmaier & Söhne GmbH + Co. KG, Rosenberg, Germany) and nest material (nestlets: Ancare, UK agents ...
-
No products found
because this supplier's products are not listed.
Thanh Ngoc Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... aqueous uranyl acetate (5 min) and Reynolds lead citrate (3 min) before routine imaging on a JEM-1400PLUS TEM (JEOL). For quantification ...
-
No products found
because this supplier's products are not listed.
Kunal Sharma, et al.,
bioRxiv - Microbiology 2021
Quote:
... the bladder-chip was attached to an adhesive conductive surface followed by coating with a 3 – 4 nm thick layer of gold palladium metal (Quorum Q Plus, Quorum Technologies). Images of the cells were captured using a field emission scanning electron microscope (Merlin ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Neuroscience 2021
Quote:
RNA was extracted from mouse brain lysates (mixture of 3∼4 mouse brains for each sample) using RNAprep pure Tissue Kit (Tiangen, DP431). cDNA was synthesized using HiScript II 1st Strand cDNA Synthesis Kit (Vazyme ...
-
No products found
because this supplier's products are not listed.
Janani Ramachandran, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Differential SMARCC1 binding between E11.5 (40-43s) control (Gli3+/+; n=3) and Gli3-/- (n=4) samples was conducted using an E.coli spike-in (EpiCypher 18-1401) of 0.125ng/sample ...
-
No products found
because this supplier's products are not listed.
Haley M. Scott, et al.,
bioRxiv - Immunology 2023
Quote:
... Lenti-X cells were transfected with a pSICO scramble non-targeting shRNA construct and pSICO Srsf7 shRNA constructs targeted at exon 3 and exon 4 of Srsf7 using Polyjet (SignaGen Laboratories). Virus was collected 24 and 48 h post transfection ...
-
No products found
because this supplier's products are not listed.
Yanan Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 8 ng/mL Cholera Toxin (CELL technologies), 5 ng/mL insulin (CELL technologies) ...
-
No products found
because this supplier's products are not listed.
Maike S Adamson, et al.,
bioRxiv - Immunology 2022
Quote:
... MEM non-essential amino acids,) containing 100 pg/ml M-CSF (ImmunoTools, Friesoythe, Germany) at a density of 106 cells/ml ...
-
No products found
because this supplier's products are not listed.
Ryan M. Glanz, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a pup with a visible milk band was removed from the litter and anesthetized with isoflurane gas (3–5%; Phoenix Pharmaceuticals, Burlingame, CA). A custom-made bipolar hook electrode (0.002-inch diameter ...
-
No products found
because this supplier's products are not listed.
Amber Gonda, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Samples were lysed and incubated for 5 minutes in Trizol and then 1-bromo-3-chloropropane (BCP) (Molecular Research Center, Inc. Cincinnati, OH) was added to separate the RNA from the remaining material ...
-
No products found
because this supplier's products are not listed.
Veronica Calvo, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Primary antibodies used were anti-cytokeratin 8/18 (Progen), smooth muscle actin-Cy3 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Xiaoqing Cheng, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Cytokeratin 8/18 Antibody (Fitzgerald Industry International, 20R-CP004), phospho-p44/42 MAPK (Erk1/2 ...
-
No products found
because this supplier's products are not listed.
Georgios I. Laliotis, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The RNA pellet was washed with 75% ethanol followed by spin at 7,500 x g for 5 min at 4 °C and dissolved in 30 µl DEPC-treated water (IBI Scientific, Cat. No. IB42210). Protein extraction ...
-
No products found
because this supplier's products are not listed.
Thadeu Estevam Moreira Maramaldo Costa, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Polycarbonate membrane filters with 8 µm pore size (Neuro Probe) were placed between the lower and upper chambers ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Jacqueline F. Rivera, et al.,
bioRxiv - Neuroscience 2023
Quote:
The amino terminal domain of GluA1 (1-394 a.a.) fused to a biotin acceptor tag (AviTag, Avidity) grown in suspension cultures of Sf9 cells was used as a target for the mRNA display selection ...
-
No products found
because this supplier's products are not listed.
Tayler D. Sheahan, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3 µM (Adooq Bioscience A18250); oxytocin ...
-
No products found
because this supplier's products are not listed.
Parbir S. Grewal, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Oleate induction media was prepared as 6.7 g/L Difco Yeast Nitrogen Base without amino acids (Spectrum Chemical); 2 g/L Drop-out Mix Synthetic minus appropriate amino acids ...
-
No products found
because this supplier's products are not listed.
Blanca V. Rodriguez, et al.,
bioRxiv - Immunology 2023
Quote:
... with the “Mix” mode selected at a speed of 8 rpm (Benchmark Scientific Roto-Therm Plus Incubated Rotator ...
-
Alginate 5% is a viscous alginate hydrogel, suitable for both bioprinting and casting. You can...
Cat# IKA325000503,
5 mL, USD $220.0
Ask
Amber L. Altrieth, et al.,
bioRxiv - Cell Biology 2023
Quote:
Collagen hybridizing peptide (CHP) conjugated to 5-carboxyfluorescein (5-FAM) (Advanced BioMatrix) was solubilized per manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Csaba Matta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-MMP-3 (Aviva Systems Biology ARP42042_P050), anti-MMP-13 (Aviva Systems Biology ARP56350_P050) ...
-
No products found
because this supplier's products are not listed.
Itamar Harel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... equipped with 3 emCCDs (Evolve, Photometrics Inc.) using an Olympus UPlanApo 100x (NA 1.40 ...
-
No products found
because this supplier's products are not listed.
Ugo Dionne, et al.,
bioRxiv - Systems Biology 2020
Quote:
... prey strains are each expressing a gene of interest fused at its 3’ end to the DHFR F[3] and are resistant to hygromycin B (HPH 250 μg/ml, Bioshop Canada). The same BY4741 strains were used in the growth assays with the addition of knockout (KO ...
-
No products found
because this supplier's products are not listed.
Christopher W Fell, et al.,
bioRxiv - Neuroscience 2021
Quote:
... were washed once with PBS and incubated for 4 hours with 100µg/ml fluoresceinamine labelled glycosaminoglycans: 4-O-sulfated chondroitin sulphate (AMS.CSR-FACS-A1, AMSBIO), poly-sulphated chondroitin sulphate (AMS.CSR-FACS-P1 ...
-
No products found
because this supplier's products are not listed.
Dennis Schifferl, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... in 4 ml glass vials (Wheaton 224882) and processed as described previously (Schifferl et al 2021) ...
-
No products found
because this supplier's products are not listed.
Heon Shin, et al.,
bioRxiv - Molecular Biology 2023
Quote:
DNA damage was analyzed using EpiQuik 8-OHdG DNA Damage Quantification Direct Kit (P-6003, EpiGentek) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Sven Klumpe, et al.,
bioRxiv - Biophysics 2021
Quote:
... 5 ug/ml Insulin (Cell Applications), 10 mM HEPES (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
No products found
because this supplier's products are not listed.
VP O’Brien, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5% defibrinated horse blood (Hemostat Labs), 10 mg/ml vancomycin (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Thomas R. Gawriluk, et al.,
bioRxiv - Immunology 2019
Quote:
... one of the 8 mm biopsies was placed into 10% (v/v) neutral buffered formalin (American MasterTech, McKinney, TX) overnight ...
-
No products found
because this supplier's products are not listed.
Takuma Uo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Uptake of 3H-3-O-methylglucose (American Radiolabeled Chemicals, St. Louis, MO) and 3H-2-deoxyglucose (Perkin Elmer ...
-
No products found
because this supplier's products are not listed.
Djem U. Kissiov, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... In all cases medium contained 5% FCS (Omega Scientific), 0.2 mg/mL glutamine (Sigma) ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Jonathan H. Shrimp, et al.,
bioRxiv - Biochemistry 2020
Quote:
... was added 7-amino-methylcoumarin (62.5 nL) and inhibitor or DMSO (62.5 nL) using an ECHO 655 acoustic dispenser (LabCyte). To that was added assay buffer (50 mM Tris pH 8 ...