-
No products found
because this supplier's products are not listed.
Laura E. de Vries, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 3-5% human blood type O red blood cells (RBCs) (Sanquin, the Netherlands) at 37°C in 3% O2 ...
-
No products found
Mohummad Aminur Rahman, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Vivian K. Rojas, et al.,
bioRxiv - Microbiology 2024
Quote:
... The chromogenic molecule X-Phos (5-bromo-4-chloro-3-indolyl phosphate, Chem-Impex) was added to agar plates with the purpose of detecting S ...
-
No products found
because this supplier's products are not listed.
Alina Ainbinder, et al.,
bioRxiv - Genetics 2021
Quote:
... An in vitro transcribed sgRNA targeting Slc16a11 (5’-AGTCCTAACCTCGCTTGGCT-3’) and hspCas9 mRNA (CAS500A-1, System Biosciences) were microinjected into C57BL/6J mouse zygotes by the Genome Modification Facility at Harvard University ...
-
No products found
because this supplier's products are not listed.
Wenli Yang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 8-(4-Chlorophenylthio)-2’-O- methyladenosine-3’,5’-cyclic monophosphate acetoxymethyl ester (007-AM) was from Axxora (Cat. # BLG-C051). DAPI (Cat ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... which were diluted 1:100 in triplicate into 5 mL fresh CHG media containing either 100 μM of the corresponding substrate (either LCA [Sigma] or 3-oxoLCA [Steraloids]). Cultures were grown for 48 hours at 37 °C ...
-
No products found
because this supplier's products are not listed.
Jennifer G. Abelin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (35 cm, 1.9µm C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 µm inner diameter ...
-
No products found
because this supplier's products are not listed.
Elsio Wunder Jr., et al.,
bioRxiv - Microbiology 2020
Quote:
... coli HY system (5 PRIME) and synthesized crude proteins were printed on 3-pad nitrocellulose-coated AVID slides (Grace Bio-Labs) using a Gene Machine OmniGrid 100 microarray printer (Genomic Solutions) ...
-
No products found
because this supplier's products are not listed.
Oliver D Caspari, et al.,
bioRxiv - Plant Biology 2022
Quote:
... selected for Paromomycin resistance were grown in 200μl TAP in 96-well plates under 50μmol photons m-2 s-2 for 3-5 days and then screened for Venus expression in a fluorescence plate reader (CLARIOstar, BMG Labtech) as described previously (Caspari ...
-
No products found
because this supplier's products are not listed.
Fiorella Ghisays, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO), denatured at 75°C for 5 minutes and incubated at room temperature for 16hr ...
-
No products found
because this supplier's products are not listed.
Xiao Lin, et al.,
bioRxiv - Genomics 2020
Quote:
... Genomic DNA was resuspended in water and sheared into 3-5 kb fragments using the S220 Focused-ultrasonicator (Covaris Inc., MA, USA).
-
No products found
because this supplier's products are not listed.
Alan Bush, et al.,
bioRxiv - Neuroscience 2021
Quote:
... strips with 54 or 63 contacts each (platinum 1 mm disc contacts arranged in a 3×18 or 3×21 layout, with 3 mm center to center spacing, PMT Cortac Strips models 2110-54-001 and 2011-63-002 ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, James A. Van Deventer,
bioRxiv - Synthetic Biology 2021
Quote:
... 3-Amino-L-tyrosine (Bachem), 4-Amino-L-phenylalanine (Bachem) ...
-
No products found
because this supplier's products are not listed.
Susanne Wiemann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3 % goat serum (Dianova, Hamburg, Germany), and 0.5 % Triton™-X-100 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... cleaved-caspase 3 (1:1000, Bioworld), Pro-Caspase 3 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Alexander D. Silvagnoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Absorbance spectra were generated using a multipoint 3×3 well scan of each well from 450 to 700 nm with a plate reader (Tecan Spark). Preliminary experiments determined that there was a significant difference in absorption by the phantom pucks when the absorbance was read at room temperature (approx ...
-
No products found
because this supplier's products are not listed.
Giulio Giuliani, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5% horse serum (HS) (Euroclone ECS0090D) and 1 ng/ml TGF-beta-1 (PreproTech 100-21) ...
-
No products found
because this supplier's products are not listed.
Michael J. Hoy, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5 M Sodium Chloride (Teknova #S0251), TCEP (Soltec Ventures Inc #M115) ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a polyethylene tubing (3 mm inner diameter; A-M Systems), which acted as the active electrode for tRNS ...
-
No products found
because this supplier's products are not listed.
Desingu Ayyappa Raja, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... at 5% CO2 (Eppendorf® New Brunswick Galaxy170S). Media was changed every day and cells were passaged upon reaching 80% confluence ...
-
No products found
because this supplier's products are not listed.
Tianyang Mao, et al.,
bioRxiv - Immunology 2021
Quote:
The triphosphorylated RNA oligonucleotides SLR-14 (5′ pppGGAUCGAUCGAUCGUUCGCGAUCGAUCGAUCC-3′ and SLR-14-amino (5′ pppGGAUCGAUCGAUCGUXCGCGAUCGAUCGAUCC-3′ where X = aminomodifier C6dT; Glen Research) were prepared as described57 ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
F. Phil Brooks III, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a stack of one 5 mm and two 3 mm round cover glass (Thomas Scientific, 1217N66), pre-glued by optical glue (Norland 61) ...
-
No products found
because this supplier's products are not listed.
Maximilian Donsbach, et al.,
bioRxiv - Biochemistry 2022
Quote:
... the complementary 5’-phosphorylated oligonucleotides (AP-ICL top: 5’-GCA CCT TCC GCT CdUT CTT TC-3’ and AP-ICL bottom: CCC TGA AAG AAG AGC GGA AG) heated for 5 min at 95°C in 30 mM HEPES-KOH pH 7.0 ...
-
No products found
because this supplier's products are not listed.
Carole Fruchart Gaillard, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... cells were incubated for 2h at 37°C with 5 μg/ml DiI-LDL (1,1’-dioctadecyl-3,3,3’,3’-tetramethyl-indocarbocyanine perchlorate, Cedarlane/Kalen Biomedical) in SFM media before fixation ...
-
No products found
because this supplier's products are not listed.
Hannes Maib, David H. Murray,
bioRxiv - Cell Biology 2021
Quote:
... were produced by mixing 95 mol % 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) with 5 mol % of the respective phosphatidylinositol together with 0.1% Atto647N-DOPE (ATTO-TEC) or Rhodamine-DOPE ...
-
No products found
because this supplier's products are not listed.
Adar Sonn-Segev, et al.,
bioRxiv - Biophysics 2019
Quote:
... and the supernatant applied for 3 h at 4°C to 5 mL of Toyopearl AF-Chelate-650M resin (Tosoh) precharged with Ni2+-ions ...
-
No products found
Lissenya B. Argueta, et al.,
bioRxiv - Cell Biology 2021
Quote:
... hESC-qualified)-coated plates at 4×10^5/well in 24-well plates or 3×10^4/well in glass-like polymer bottom 96-well plates (CellVis).
-
No products found
because this supplier's products are not listed.
Wassim Eid, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit polyconal to 14-3-3 (SA-483, Biomol); rabbit polyconal to CHK1-pS345 (2348S ...
-
No products found
because this supplier's products are not listed.
Teresa Krammer, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... under accession codes GSExxxxxx (FOXA2+ vs FOXA2- cells at Day 5, Figure 3) and GSExxxxxx (FOXA2+ vs FOXA2- cells after BMP perturbations, Figure 4).
-
No products found
because this supplier's products are not listed.
Jack M. O’Shea, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 5 μg of MBP in 5 μL (RayBiotech) was mixed with 15 μL of lysis buffer and 200 μL of pseudocytosol with 0 ...
-
No products found
because this supplier's products are not listed.
Lauren T. Que, Marie E. Morrow, Cynthia Wolberger,
bioRxiv - Biochemistry 2019
Quote:
... 5 (LifeSensors) FRET-K48 diubiquitin ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Erica J. Polleys, et al.,
bioRxiv - Genetics 2022
Quote:
... or a-Rad51 (3 uG; Agrisera AS07 214) for 2 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 ng/mL mrIL-3 (Gemini bio-products), and 10 ng/mL mrIL-6 (Gemini bio-products) ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
Human pulmonary artery endothelial cells HPAEC (3 × 105/well) derived from 3 separate individuals were cultured in 6 well plates with ECM media (ScienCell, Carlsbad, CA) then treated with TGF-β (10 ng/ml) ...
-
No products found
because this supplier's products are not listed.
Sven Klumpe, et al.,
bioRxiv - Biophysics 2021
Quote:
... 5 ug/ml Insulin (Cell Applications), 10 mM HEPES (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Andrew N. Stewart, et al.,
bioRxiv - Neuroscience 2023
Quote:
Serotonin (5-HT) positive axons were identified using chromogen labeling against 5-HT (1:4000; 20080; ImmunoStar) and were either not co-labeled in the first acute experiment ...
-
No products found
because this supplier's products are not listed.
Wei Shi, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5 μL washed Myc magnetic beads (Chromotek) were added to the protein extracts of each sample and samples were then incubated on a rolling wheel at 4°C ...
-
No products found
because this supplier's products are not listed.
Olamide Ishola, et al.,
bioRxiv - Biochemistry 2024
Quote:
... aliquots of the apoAI-EfpA in β-DDM and in lipid were placed in 1.5 ml tubes and then mixed with 5 nm Gold Nanoparticles (5-nm Gold-Ni-NTA, Nanoprobes) (GNPs ...
-
No products found
because this supplier's products are not listed.
Jacob W. Myerson, et al.,
bioRxiv - Bioengineering 2020
Quote:
... with separate compartments for each mouse (MPC-3 AERO; Braintree Scientific). To maintain adequate hydration ...
-
No products found
because this supplier's products are not listed.
Felix Jonas, Gilad Yaakov, Naama Barkai,
bioRxiv - Genomics 2022
Quote:
... Cells were processed for 3 cycles in a Bullet Blender 24 (Next Advance) at level 8 for 1 min ...
-
No products found
because this supplier's products are not listed.
Chisato Kunitomi, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Female mice (3-4 weeks old) were intraperitoneally injected with 5 IU pregnant mare serum gonadotropin (PMSG; MyBioSource, MBS173236) to induce follicle growth ...
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... LAG-3 (LA3-H5255; Acrobiosystems), TIM-3 (TM3-H5258 ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 ug-mL-1 Human IgM (Innovative Research), a classical pathway activator ...
-
No products found
because this supplier's products are not listed.
Alexis S. Zajicek, et al.,
bioRxiv - Neuroscience 2021
Quote:
... blots were stripped between probes with Membrane Stripping Buffer-3 (Boston BioProducts). Signals were detected using SuperSignal West Femto Maximum Sensitivity Substrate Kit (Pierce ...