-
No products found
because this supplier's products are not listed.
Toshiharu Ichinose, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The ribosome-bound mRNA was eluted with 50 µl of 100 µg/ml 3× FLAG peptide (GEN-3XFLAG- 25, Protein Ark) dissolved in the lysis buffer.
-
No products found
because this supplier's products are not listed.
Blake Skanes, et al.,
bioRxiv - Plant Biology 2020
Quote:
... HPLC grade acetonitrile (99.9% purity) and methanol (99.8% purity) were obtained from Caledon Laboratory Chemicals (Georgetown ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Ioannis Kanakis, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Samples were processed with Clip-Clap™ Acid Pyrophosphatase (Cambio, UK) prior to the library preparation to remove any 5’ cap structures ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Maria Kuzikov, et al.,
bioRxiv - Molecular Biology 2023
Quote:
5 µl/ 100 nM of USP7/USP14 (BPS bioscience, #80364) were added to assay plates containing the compounds ...
-
No products found
because this supplier's products are not listed.
Ziad Al Tanoury, et al.,
bioRxiv - Cell Biology 2020
Quote:
... (100 W RF, Plasma Prep II, SPI Supplies, West Chester, PA) to promote gelatin adhesion ...
-
No products found
because this supplier's products are not listed.
Robert S. Kiss, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 0.5% Triton-X-100 and EDTA-free protease-inhibitor solution (Expedeon), 50mM Tris ...
-
No products found
because this supplier's products are not listed.
S. Naseeb, et al.,
bioRxiv - Genetics 2021
Quote:
... high-resolution images of phenotypic plates were taken using Phenobooth after 3 days of incubation (Singer Instruments, UK). The colony sizes were calculated in pixels using Phenosuite software (Singer Instruments ...
-
No products found
because this supplier's products are not listed.
Yuhan Jiang, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 75 µL of the cell lysate was mixed with 100 µL of 70% nitric acid (Fisher chemical, Cat# A509P212) in 15 mL metal-free tube (Labcon, Cat# 3134-345-001-9). The samples were heated in 60°C water bath for 1 h to make sure the sample is fully digested ...
-
No products found
because this supplier's products are not listed.
Philippe Dehio, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The thawed cells were resuspended in complete medium & 10 ng / ml GM-CSF and 100 ng / ml LPS (Lucerna Chem, Cat. # abx082480) and matured for 14 h for migration experiments.
-
No products found
because this supplier's products are not listed.
Rene Yu-Hong Cheng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 3 mL syringes (Becton Dickinson) were connected to the bead and sample inlet reservoirs via PEEK tubing (IDEX) and a coupler molded out of PDMS ...
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were washed 3 times and incubated with 100 μL HRP-conjugated anti-mouse IgG secondary antibody (L20/01; HyTest; 1:25000) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Seren Hamsici, Gokhan Gunay, Handan Acar,
bioRxiv - Bioengineering 2022
Quote:
... Fmoc protected amino acids (Gyros Protein Technologies) were removed through treatment with 20% piperidine/DMF solution for 45 min (three times for 15 min ...
-
No products found
because this supplier's products are not listed.
Esther Cañibano, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 2 ug total RNA extracted from 7 day old seedlings with the Favorprep Plant Total RNA Purification Mini kit (Favorgen) was used for cDNAs synthesis with using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... with 14.16□g of HEPES acid (STREM Chemicals) and 16.65 g of HEPES sodium salt (STREM Chemicals) ...
-
No products found
because this supplier's products are not listed.
Richard J. R. Kelwick, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Nanoparticle tracking analysis (NTA): 1 μL A549 EVs (1 mg/ml; #HBM-A549-100/5, HansaBioMed, Tallinn, Estonia) were diluted (1:1000 ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1002,
Inquiry
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Zhimin Zhou, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and 2.5 g fatty acid-free BSA (Proliant Biologicals).
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Zoology 2020
Quote:
... gel containing 1× RedSafe Nucleic Acid Staining Solution (FroggaBio) and electrophoresed in 1× Tris-Acetate-EDTA (TAE ...
-
No products found
because this supplier's products are not listed.
Jihye Kim, et al.,
bioRxiv - Microbiology 2019
Quote:
... The isolated choroid plexuses were incubated in HBSS with Mg2+ and Ca2+ containing 100 µg/mL DNase I (Akron Biotechnology) for 20 min at 37 °C followed by washing in PBS twice ...
-
No products found
because this supplier's products are not listed.
Aishan Zhao, et al.,
bioRxiv - Microbiology 2021
Quote:
... Trifluoroacetic acid (TFA) was purchased from Halocarbon (North Augusta, SC). Talon cobalt resin was from Clontech (Mountain View ...
-
No products found
because this supplier's products are not listed.
Anaïs Beauvieux, et al.,
bioRxiv - Physiology 2024
Quote:
... multi-element calibration standards (SCP Science, in 4% nitric acid) were assembled with different concentrations of inorganic elements ...
-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Alena Aliashkevich, et al.,
bioRxiv - Microbiology 2020
Quote:
3 gr of seeds (e.g. Medicago sativa) were mashed and soaked in 10 mL of water overnight followed by centrifugation at 5,000 rpm to remove the particulate fraction ...
-
No products found
because this supplier's products are not listed.
Robert L. McPherson, et al.,
bioRxiv - Biochemistry 2022
Quote:
... or YCFAC medium (Yeast Casitone Fatty Acids Agar with Carbohydrates, Anaerobe Systems). Liquid cultures were established for each isolate through the inoculation of a single colony into 5-10 mL of media ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Arman Izadi, et al.,
bioRxiv - Immunology 2023
Quote:
... XBB (#158-40589-V08H40-100) and BQ1.1(158-40589-V08H41-100) was aquired from Nordic biosite. 25 µg of Spike protein was biotinylated according to the instructions of EZ-LinkTM Micro Sulfo-NHS-LCBiotinylation Kit (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Fumiyuki Hatanaka, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 1:100 (MCA-1B7, EnCor Biotechnology); anti-ChAT ...
-
No products found
because this supplier's products are not listed.
Xiaodan Zhang, et al.,
bioRxiv - Genomics 2021
Quote:
... anti-mouse Lyve1 antibody (1:100, AngioBio cat.no ...
-
No products found
because this supplier's products are not listed.
Joy Lachat, et al.,
bioRxiv - Microbiology 2021
Quote:
... a Piezo stage (Prior Scientific, NanoScanZ 100), an environmental chamber with temperature control set to 37°C and a Definite Focus 2 device (Zeiss ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Jiyeon Leem, Jae-Sung Kim, Jeong Su Oh,
bioRxiv - Cell Biology 2022
Quote:
... anti-centromere (1:100, 15-234, Antibodies Incorporated), anti-CIP2A (1:500 ...
-
No products found
because this supplier's products are not listed.
Priscille Riondel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... using the vertical PC-100 puller (Narishige International Ltd) and filled with an internal solution supplemented with 10 μM of the fluorescent dye AlexaFluor 594 (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Jesus M. Duran Ramirez, et al.,
bioRxiv - Microbiology 2022
Quote:
... 100 uL of either sterile saline (McKesson, cat# 186661) or the TAPI (prepared as described above ...
-
No products found
because this supplier's products are not listed.
Esther W. Lim, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 400 µL saline and 100 µL of water spiked with deuterated internal standards (100 picomoles of D7-sphingosine (Avanti, Croda International Plc, 860657), 20 picomoles of D7-sphinganine (Avanti ...
-
No products found
because this supplier's products are not listed.
Ge Song, et al.,
bioRxiv - Immunology 2020
Quote:
... YP_003767.1) and HCoV-229E (1173 amino acids; GenBank: NP_073551.1) were cloned into the mammalian expression vector phCMV3 (Genlantis, USA) using PstI and BamH restriction sites ...
-
No products found
because this supplier's products are not listed.
Mari Suzuki, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Clone C92F3-5 (StressMarq Biosciences Cat# SMC-100, 1:2000); anti-HSP90 ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
... depleted plasma was supplemented with purified FXI (100 pM; Haematologic Technologies) or FXII (1.2 nM ...
-
No products found
because this supplier's products are not listed.
Matthew B. Lohse, et al.,
bioRxiv - Genetics 2020
Quote:
... samples were acidified to pH 2 with 5 µL of 20% formic acid (JT Baker 0128-01) before desalting with C18 Desalting Tips (Rainin 17014047). Samples were eluted in 40µL of a 50:50 acetonitrile (Sigma 34851 ...
-
No products found
because this supplier's products are not listed.
Dalia Rosano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
CloneTracker XP 10M Barcode-3’ Library with RFP-Puro (BCXP10M3RP-P) was purchased from Cellecta. Production of lentiviral particles and MCF7 transduction was performed following CloneTracker™ XP Lentiviral Expressed Barcode Libraries online manual (https://manuals.cellecta.com/clonetracker-xp-lentiviral-barcode-libraries/) ...
-
No products found
because this supplier's products are not listed.
Dario Campagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The brain was sectioned coronally (100 μm) with a vibrotome (Campden Instruments) in ice-cold PBS (0.1 M) ...
-
No products found
because this supplier's products are not listed.
Yiyao Huang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... from 5 ml to 0.5 ml before application onto qEV Original SEC columns (IZON Science SP1-USD, Christchurch, New Zealand) that had been pre-rinsed with 15 ml PBS ...
-
No products found
because this supplier's products are not listed.
Richard J. Wheeler, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 30 or 100 µM final concentration were added by acoustic dispensing (Labcyte Echo 550) to 96 well plate wells containing 3 µl FUS GFP diluted in 50 mM Tris·HCl pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
No products found
because this supplier's products are not listed.
Yuanchen Yu, et al.,
bioRxiv - Microbiology 2020
Quote:
... The channel array was maintained at 37 °C with a TC-1-100s temperature controller (Bioscience Tools). For all direct comparisons ...
-
No products found
because this supplier's products are not listed.
Olivia E. Harwood, et al.,
bioRxiv - Immunology 2023
Quote:
... were coated with 0.5 μg/mL SIVmac239 gp120 (Immune Technology, New York, NY) in coating buffer (2.25mg/mL Na2CO3 and 4.395mg/mL NaHCO3 in distilled H2O) ...