-
No products found
because this supplier's products are not listed.
Kyle Vaccaro, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Cells were blocked with 100 ug/mL mouse IgG (Lampire Biological Laboratories) or Human TruStain FcX (BioLegend) ...
-
No products found
because this supplier's products are not listed.
Shrestha Mathur, et al.,
bioRxiv - Microbiology 2023
Quote:
... Half of each sample was incubated with 100 ug/mL Proteinase K (Epoch Life Science) at pH 8.0 at 37°C for 30 mins ...
-
No products found
because this supplier's products are not listed.
Tiphaine C. Martin, et al.,
bioRxiv - Immunology 2019
Quote:
... Individuals were considered to have AITD if they had a positive TPOAb titer (3 times more than the threshold set by the manufacturer [18 IU/mL for Abbott assay and 100 IU/mL for Roche assay]) or had a TSH level more than 10 mIU/L ...
-
No products found
because this supplier's products are not listed.
Marcelo Febo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... ‘Leakproof’ bottles (100 ml, graduated by 1 ml) with stoppers and sipper tubes were purchased (Braintree Scientific Inc ...
-
No products found
because this supplier's products are not listed.
Erika Ganda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5 mL of sterile water and 5 mL of 100% ethanol (Decon Labs, King of Prussia, PA) were added to the tube and the pellet was resuspended by vortexing ...
-
No products found
because this supplier's products are not listed.
Mackenzie T. Walls, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... the overnight culture was used to inoculate 3 mL of SC media (Sunrise Science Products) with 2% (w/v ...
-
No products found
because this supplier's products are not listed.
Lamiaa El-Shennawy, et al.,
bioRxiv - Immunology 2020
Quote:
RBD of 223 amino acid (Arg319-Phe541) fragment of the SARS-CoV-2 Spike protein that binds to the ACE2 receptor (Raybiotech, 230-30162-100) was biotinylated using NHS-PEG4-Biotin (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Ling-Zhen Liu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the cells incubated with 100 μg/mL FITC-OVA (Bioss, Cat bs-0283P-FITC), FITC-Bm-SA (FITC-labeled toad B ...
-
No products found
because this supplier's products are not listed.
Akinori Eiyama, et al.,
bioRxiv - Cell Biology 2024
Quote:
... a 100× objective lens (αPlan-APOCHROMAT 100, NA: 1.46; Carl Zeiss), a monochrome CCD camera (AxioCam MRm ...
-
No products found
because this supplier's products are not listed.
Jéssica C. dos Santos, et al.,
bioRxiv - Systems Biology 2022
Quote:
... (10 ug/mL - EMC microcollections; TLR2 ligand)) ...
-
No products found
because this supplier's products are not listed.
Andrew V. Grassetti, Rufus Hards, Scott A. Gerber,
bioRxiv - Cell Biology 2021
Quote:
... lyophilized peptides were dissolved in 50% acetonitrile (ACN; Honeywell) / 2M lactic acid (Lee Biosolutions), incubated with 1.25 mg TiO2 microspheres (GL Sciences ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Nazish Sayed, et al.,
bioRxiv - Immunology 2019
Quote:
... The cells were resuspended in 100 uL PBS buffer containing 2 ug/mL Live-Dead (DOTA-maleimide (Macrocyclics) containing natural-abundance indium) ...
-
No products found
because this supplier's products are not listed.
Mohammad Tohidul Amin, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and 3-hydroxyvaleric acid (AdooQ BioScience, Irvine, CA).
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
John J. McInnis, et al.,
bioRxiv - Neuroscience 2023
Quote:
... in 47.5 mL borate buffer (100 mM Boric Acid, 75 mM Sodium Chloride, pH 8.4, Boston Bioproducts Inc. C-8852S) overnight at room temperature ...
-
No products found
because this supplier's products are not listed.
Conall Sauvey, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... supplemented with penicillin (100 U/mL) and streptomycin (100 μg/mL) (Omega Scientific) [17] ...
-
No products found
because this supplier's products are not listed.
Li-Ying Yu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Human recombinant GDNF (100 ng/mL) (P-103-100, Icosagen) or a condition without any trophic factor were used as positive and negative controls ...
-
No products found
because this supplier's products are not listed.
Jiwon Jeong, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The primary antibodies used in immunostaining included rabbit anti-DSK (Boster Bio, DZ41371; diluted at 0.5 ug/ml) and mouse anti-BRP antibodies (Developmental Studies Hybridoma Bank ...
-
No products found
because this supplier's products are not listed.
Kannan Govindaraj, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 100 ng/ml bFGF (Neuromics, RP80001), and 100 U/ml of Penicillin-Streptomycin (15140122 ...
-
No products found
because this supplier's products are not listed.
Apirat Chaikuad, et al.,
bioRxiv - Biochemistry 2019
Quote:
... the 5 uL reaction was performed with 4 ug/mL recombinant human ULK2 protein (1-478, SignalChem #U02-11G) and 80 ug/mL MBP in the presence of 25 uM ATP ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Masayoshi Nagai, et al.,
bioRxiv - Biochemistry 2024
Quote:
... One ug of recombinant designer demethylated nucleosomes (EpiCypher) was incubated with the PHF21A-containing complexes from 293T cells ...
-
No products found
because this supplier's products are not listed.
Sarah A Fahlberg, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3 μg/mL anti-myc IgY (Aves Labs) conjugated with Alexa488 using NHS chemistry ...
-
No products found
because this supplier's products are not listed.
Chikako Kuwabara, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3 ml/L Plant Preservative Mixture (Plant Cell Technology), and 3 g/L phytagel ...
-
No products found
because this supplier's products are not listed.
Laura Lorenzo-Orts, et al.,
bioRxiv - Biochemistry 2019
Quote:
... biotinylated medium chain polyP (5-20 ug/uL, Kerafast) or 5’-biotinylated single-strand DNA (5 ug/uL ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Ibrar Siddique, et al.,
bioRxiv - Cell Biology 2021
Quote:
... supplemented with 10% fetal bovine serum (FBS) and a penicillin-streptomycin solution (100 units/mL of penicillin and 100 μg/mL of streptomycin, Caisson labs, PSL01). SH-SY5Y cells were plated at 30,000 cells per well in 8-chamber slides and grown to 60% confluency.
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Histological analysis was performed on thoracic spines fixed in 10% neutral-buffered formalin for 3 days at room temperature followed by 1-week decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Morten Dencker Schostag, et al.,
bioRxiv - Microbiology 2019
Quote:
... Gas samples were transferred to 3-mL Exetainer vials (LABCO, Lampeter, UK) and analyzed using an autosampler (Mikrolab Aarhus ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Emma A. Quinn, et al.,
bioRxiv - Microbiology 2021
Quote:
... PCR products were visualised using 2 % (w/v) agarose/TBE gels stained with 3 μL Greensafe premium nucleic acid stain (NZYTech, Lisboa, Portugal). TBE gels consisted of 100 mL 1x TBE buffer ...
-
No products found
because this supplier's products are not listed.
Yan Liu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a booster injection with 100 µl of an emulsion of bovine collagen II (100 µg, 50 µl in 0.01 M acetic acid) and Incomplete Freund’s Adjuvant (IFA, 50 µl; Chondrex Inc, Woodinville, WA) was administered intradermally at a different location of the mouse tail ...
-
No products found
because this supplier's products are not listed.
Yuuki Wittmer, et al.,
bioRxiv - Biophysics 2022
Quote:
TIA1 LC domain fibrils were prepared by concentrating the protein to ∼2.5 mg/mL in a ∼6 mL volume using Millipore Amicon Ultra-15 3 kDa MWCO centrifugal filter and dialyzed (Spectrum Laboratories 1.7 ml/cm standard SpectraPor 1 RC Tubing ...
-
No products found
because this supplier's products are not listed.
Patrick Marsall, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 µg/mL R-phycoerythrin-labeled goat anti-human IgG antibody (109-116-098, Dianova) diluted in assay buffer was added to each well and incubated for 45 mins ...
-
No products found
because this supplier's products are not listed.
Annemarie Kralt, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Digestion was quenched by addition of 3% (v/v) of 100% formic acid (pH ∼2.0 ) and peptides were desalted in a BioPureSPN MACRO spin columns (The Nest Group, Inc.) as described above (Tryptic in-gel digestion) ...
-
No products found
because this supplier's products are not listed.
Keren Ben-Yehuda, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Then, the sample was suspended in human tubal fluid (HTF, 3 mL) medium (Irvine Scientific, CA, USA) and placed on top of a 40% and 80% silicon bead gradient and centrifuged for 20 min at 1750 rpm ...
-
No products found
because this supplier's products are not listed.
Antwi-Boasiako Oteng, et al.,
bioRxiv - Physiology 2021
Quote:
... non-esterified fatty acids (Wako Diagnostics), and cholesterol (Cholesterol E ...
-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... stearic acid (NU-CHEK PREP, INC) were conjugated with fatty acid free BSA (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Flavia Chiuppesi, et al.,
bioRxiv - Immunology 2020
Quote:
... 5 ug of fragmented DNAs were converted to SMRTbell libraries using the SMRTbell Template Prep Kit 1.0 (PacBio). The libraries were size-selected (7-kb size cutoff ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Vineet Choudhary, et al.,
bioRxiv - Cell Biology 2020
Quote:
... an amino acid mix (United States Biologicals), containing either 2% glucose ...
-
No products found
because this supplier's products are not listed.
Alan Bush, et al.,
bioRxiv - Neuroscience 2021
Quote:
... strips with 54 or 63 contacts each (platinum 1 mm disc contacts arranged in a 3×18 or 3×21 layout, with 3 mm center to center spacing, PMT Cortac Strips models 2110-54-001 and 2011-63-002 ...
-
No products found
because this supplier's products are not listed.
Amit Rahi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... followed by incubation for 5 min and intermittent washing with 3 chamber volumes of buffer B: PLL PEG biotin (0.1 mg ml-1, Susos, AG), Streptavidin (0.625 mg ml-1 ...
-
No products found
because this supplier's products are not listed.
Adar Sonn-Segev, et al.,
bioRxiv - Biophysics 2019
Quote:
... and the supernatant applied for 3 h at 4°C to 5 mL of Toyopearl AF-Chelate-650M resin (Tosoh) precharged with Ni2+-ions ...
-
No products found
because this supplier's products are not listed.
Mohammad Ali Mohammad Nezhady, et al.,
bioRxiv - Cell Biology 2022
Quote:
Lentiviral shRNA against HCAR1 targeting 3’UTR regions of the gene (shHCAR1a: GCTTTATTTCAGGCCGAATGA; shHCAR1b: GCTCTGACCTTCTTCAAATCT) and the scrambled shRNA were purchased from GeneCopoeia (Cat# LPP-HSH007585-LVRU6MP-100). Targeting the 3’UTR regions allowed us to use our previous plasmid constructs for rescue experiments.
-
No products found
because this supplier's products are not listed.
Megan Chamberland, Brian Farrell, Johannes Yeh,
bioRxiv - Cell Biology 2022
Quote:
... 2 μm carboxylic acid functionalized silica spheres (Bangs Laboratory) were functionalized with octadecylamine (Sigma ...
-
No products found
because this supplier's products are not listed.
Bianca Maria Rotoli, et al.,
bioRxiv - Cell Biology 2019
Quote:
Calu-3 cells (American Type Culture Collection), obtained from a human lung adenocarcinoma and derived from serous cells of proximal bronchial airways ...