-
No products found
because this supplier's products are not listed.
Takashi Furusawa, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... obtained from Cambridge Isotope Laboratory (Andover, MA) as well as 13C6-glucose-6-phosphate and 13C6-fructose-1,6-diphosphate purchased from Medical Isotopes, Inc ...
-
No products found
because this supplier's products are not listed.
Joseph Chapman, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and stained with 100 μg/mL EM 2-3 monoclonal antibody (Squarix, SQM003.1) (1:300 in 5% BSA ...
-
No products found
because this supplier's products are not listed.
Shreyas Shah, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 3-(acrylamido)phenylboronic acid (APBA) was purchased from Boron Molecular. Sodium phosphate buffer (0.2 M ...
-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Suchitra Joshi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The estradiol levels (n=4) were also measured using an ELISA assay (#ES180S-100 Calbiotech, detection range 3 to 300 pg/mL). The intra-assay variation was 5.9% in these assays.
-
No products found
because this supplier's products are not listed.
Angel K. Kongsomboonvech, et al.,
bioRxiv - Immunology 2020
Quote:
... Stable integrants were selected in media with 50 μg/ml of mycophenolic acid (Axxora) and 50 μg/ml of xanthine (Alfa Aesar ...
-
No products found
because this supplier's products are not listed.
Nai-Wen Chi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and GCK (rabbit polyclonal, Aviva Inc. Cat. OAAF05763, 3 μg/ml). Similar staining patterns were observed (not shown ...
-
No products found
because this supplier's products are not listed.
Azlann Arnett, et al.,
bioRxiv - Immunology 2021
Quote:
RNPs were generated by mixing 1.25 ug Cas9 protein (Aldevron, Fargo, ND) and 2.5 pmol each of 3 sgRNAs (Synthego ...
-
No products found
because this supplier's products are not listed.
Oh Sung Kwon, et al.,
bioRxiv - Cell Biology 2020
Quote:
... To repress protein synthesis 100 μg/ml of cycloheximide (TOKU-E) and 300 μM of puromycin (InVivoGen ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Suchitra Joshi, Cedric L Williams, Jaideep Kapur,
bioRxiv - Neuroscience 2022
Quote:
... The steroids were extracted from the tissue with acetonitrile using a steroid tissue extraction protocol (Arbor Assays). The steroids were suspended in 50 μl ethanol ...
-
No products found
because this supplier's products are not listed.
Julia I. Ries, et al.,
bioRxiv - Microbiology 2022
Quote:
... lipopolysaccharide from Salmonella enteridis (100 ng/ml) (Hycult Biotech Uden, The Netherlands) for the AP or mannan (1 µg/ml ...
-
No products found
because this supplier's products are not listed.
Stefanie K. Menzies, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... typus venom (Product code L1403, origin South Africa, purity >99%) was sourced from Latoxan (Portes les Valence, France) and stored at 4 °C to ensure long-term stability ...
-
No products found
because this supplier's products are not listed.
Suguru Fujita, et al.,
bioRxiv - Systems Biology 2022
Quote:
... was extracted with the addition of 400 μL ice-cold methanol containing internal standards (10 mM L-methionine sulfone [Wako, Tokyo, Japan], 100 mM 2-morpholinoethanesulfonic acid [Dojindo Molecular Technologies ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Unsorted Lin− cells or sorted HSCs were cultured in a retronectin-coated 6 cm2 dish with 3 mL viral supernatants for 6 h in 3 mL IMDM media supplemented with 15% heat inactivated fetal bovine serum (Atlanta Biologicals), 1% bovine serum albumin (Gemini bio-products) ...
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Biophysics 2024
Quote:
... Plasma Surface Technology) at 100 W for 3 min and then moved to a vacuum desiccator (Bel-Art F420220000 ...
-
No products found
because this supplier's products are not listed.
Munenori Kitagawa, et al.,
bioRxiv - Plant Biology 2019
Quote:
... protoplasts were isolated from rosette leaves of 2-week old transformants that expressed OKI1∷3xYPet driven under OKI1 native promoter in oki1 background using an enzyme solution (400 mM mannitol, 20 mM MES, 20 mM KCl, 10 mM CaCl2, 10 μg/ml BSA, 15 mg/ml cellulase [PhytoTechnology Laboratories], 3 mg/ml pectolyase [Sigma-Aldrich]). Isolated protoplasts were suspended in buffer (400 mM mannitol ...
-
No products found
because this supplier's products are not listed.
Lukas-Adrian Gurzeler, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... the cells were treated with 100 μg/ml Cycloheximide (Focus Biomolecules, Cat# 10-117) and incubated for 4 min to stop translation and stabilize ribosomes on the mRNAs ...
-
No products found
because this supplier's products are not listed.
Angela Rubio, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... A total of 100 ng was used as input for the NEXTFLEX Small RNA Sequencing Kit (Version 3; Bioo Scientific), and libraries were generated following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
A.J. Middleton, et al.,
bioRxiv - Biochemistry 2021
Quote:
... at 200:200 nL and 200:100 nL protein:well solution drop ratios in Swissci 3-well sitting drop plates using a mosquito (TTP Labtech). Diffraction-quality crystals of the UbV.k.2-Ube2k complex were produced in 0.2 M sodium citrate tribasic trihydrate ...
-
No products found
because this supplier's products are not listed.
François Halloy, et al.,
bioRxiv - Molecular Biology 2020
Quote:
5 nmoles of in-vivo ready oligonucleotides (UV purity >99%, sodium salt) were spiked in 200 µl of mouse K2-EDTA plasma (BioIVT #MSE02PLK2Y2N) and 20 µl aliquots were taken immediately after mixing ...
-
No products found
because this supplier's products are not listed.
Marisol Romero-Tejeda, et al.,
bioRxiv - Cell Biology 2023
Quote:
... consisting of RPMI 1640 supplemented with 2 mg/mL fatty acid-free bovine serum albumin (GenDEPOT, A0100), 200 µg/mL L-ascorbic acid 2-phosphate (Wako, 321-44823) and 2 µM Wnt-C59 (Biorbyt, orb181132). Medium was then changed on day 4 and then every other day with RBAI consisting of RPMI 1640 supplemented with 500 µg/mL fatty acid-free bovine serum albumin ...
-
No products found
because this supplier's products are not listed.
Iuliia Polina, et al.,
bioRxiv - Cell Biology 2023
Quote:
... valproic acid (AmBeed, Arlington Heights, IL); (trifluoromethoxy)phenylhydrazone (FCCP ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Franziska Hentzschel, et al.,
bioRxiv - Microbiology 2023
Quote:
... the salivary gland sporozoite suspension was topped up to 1 ml with RPM and then carefully underlaid with 3 ml of 17 % Accudenz (in dH2O, Accurate Chemical & Scientific Corp., Westbury, NY, USA). Centrifugation for 20 min at 2800 rpm and at room temperature without break separated sporozoites from cell debris ...
-
No products found
because this supplier's products are not listed.
Felix Flomm, et al.,
bioRxiv - Microbiology 2019
Quote:
... the discs were washed in >99% Ethanol (Roth) twice by sonication for 10 minutes each and plasma cleaned in a Quorum Q150 plus (Quorum Technologies Ltd, UK) machine for 120 seconds and subsequently coated with a thin film of carbon through carbon cord evaporation ...
-
No products found
because this supplier's products are not listed.
Guodong Wang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2 ug RNA per sample were used to reverse transcript the cDNA by QuantScript RT Kit (TIANGEN Biotech, KR103). 2 x iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Isabella Pallavicini, et al.,
bioRxiv - Immunology 2023
Quote:
... checkpoint blockade was performed by intraperitoneal injection of 200 ug anti-mouse PD-L1 (clone 10F.9G2, Leinco Technologies) or isotype control anti-rat IgG2gb ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Anna Zagórska, et al.,
bioRxiv - Physiology 2020
Quote:
... in saturated aqueous solution of Picric Acid (LabChem)) ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Marcus Deichmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and RedSafe™ Nucleic Acid Staining Solution (iNtRON Biotechnology, Cat.#21141). Gel imaging was conducted on a Gel Doc XR+ System (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
C Colomer-Winter, et al.,
bioRxiv - Microbiology 2019
Quote:
... wells were coated overnight at 4°C with 100 µg ml-1 human fibrinogen free of plasminogen and von Willebrand Factor (Enzyme Research Laboratory). The next day ...
-
No products found
because this supplier's products are not listed.
Daniel A. Gittins, et al.,
bioRxiv - Microbiology 2021
Quote:
... up to 100 g of sediment was transferred into separate 250 mL serum bottles that were sealed with butyl rubber stoppers (Chemglass Life Sciences, Canada) and the headspace exchanged with N2:CO2 (90:10%) ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Mosale Seetharam Sumanth, et al.,
bioRxiv - Immunology 2019
Quote:
... with or without AGP-1 (25, 50, and 100 μg/ml) in triplicate wells in twelve well cell culture plates (Nest Biotechnology Co. Ltd., China) pre-coated with 0.2% gelatin ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Philip Jean-Richard-dit-Bressel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The center of the right side-wall included a recess (5 x 3 x 15 cm) that housed a magazine dish (3 cm diameter) into which 45mg grain pellets (Bio-Serv, NJ, USA) were delivered ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Francisco Dominguez, et al.,
bioRxiv - Microbiology 2021
Quote:
... It was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc.) between Nco I and Xho I restriction sites ...
-
No products found
because this supplier's products are not listed.
Anatoliy Belousov, et al.,
bioRxiv - Biophysics 2023
Quote:
... and 100 μL Transfection Medium (Expression Systems). The cell suspension was incubated for 4 days with shaking using a Shel Lab incubator at 27 °C and 300 rpm in 24-deep well U-bottom plates covered with Breathe-Easy membranes (Greiner BioOne) ...
-
No products found
because this supplier's products are not listed.
Sarah Moyon, et al.,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-TET2 (Epigentek, A-1701, 1:100), rabbit anti-TET3 (Abcam ...
-
No products found
because this supplier's products are not listed.
Angela Gomez-Arboledas, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Amylo-Glo (1:100, Biosensis #TR-300-AG) staining was performed before the initial blocking step ...
-
No products found
because this supplier's products are not listed.
Linda D. Hicks, et al.,
bioRxiv - Microbiology 2021
Quote:
... or 3) human factor H-depleted serum (FHDS; Complement Technology; Tyler, TX) diluted in HIB to give a 50% concentration ...
-
No products found
because this supplier's products are not listed.
Sheila Roitman, et al.,
bioRxiv - Microbiology 2022
Quote:
... TFF concentration (Repligen N06-E100-05-N, 100 kDa) optiprep (Sigma ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...
-
No products found
because this supplier's products are not listed.
Kevin R. Theis, et al.,
bioRxiv - Microbiology 2019
Quote:
... placed into a sterilized Wheaton dounce reservoir (2 ml or 5 ml; DWK Life Sciences, Millville, NJ) containing 1 ml of sterile phosphate-buffered saline (PBS ...