-
No products found
because this supplier's products are not listed.
Xingyue An, et al.,
bioRxiv - Immunology 2020
Quote:
... 2′-3’′cyclic guanosine monophosphate adenosine monophosphate (cGAMP) from Chemietek (Indianapolis, IN). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) ...
-
Single well glass bottom plate with high performance #1.5 cover glass (0.170±0.005mm). Black...
Cat# P01-1.5H,
20/case, $249.00
Ask
Lissenya B. Argueta, et al.,
bioRxiv - Cell Biology 2021
Quote:
... hESC-qualified)-coated plates at 4×10^5/well in 24-well plates or 3×10^4/well in glass-like polymer bottom 96-well plates (CellVis).
-
No products found
because this supplier's products are not listed.
Avirup Malla, Suvroma Gupta, Runa Sur,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3 activity was measured by a caspase-3 activity assay kit (Elabscience) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Thorsten M. Leucker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
No products found
because this supplier's products are not listed.
Saphala Dhital, Naren R. Vyavahare,
bioRxiv - Bioengineering 2019
Quote:
DiR (1, 1-dioctadecyl-3, 3, 3, 3-tetramethylindotricarbocyanine iodide) (PromoCell GmbH, Heidelberg, Germany) loaded BSA (Seracare ...
-
No products found
because this supplier's products are not listed.
Kazuhiro Hayashi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... ELISA kits (Mouse BDNF ELISA Kit PicoKine™ EK0309)(Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Danielle R. Adney, et al.,
bioRxiv - Microbiology 2022
Quote:
... fluorescent probe (5’-6FAM-TTGACAGGCAAACAGCACAAGCAG-BHQ1-3’) (Biosearch Technologies, Novato, CA, USA). The QPCR reactions were carried out at 50 °C for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Zilong Wang, et al.,
bioRxiv - Bioengineering 2022
Quote:
... followed by filtration with 3 MWCO 96-well plate (Pall Corporation, Port Washington, NY). Kinetex XB-C18 ...
-
No products found
because this supplier's products are not listed.
Roman Sloutsky, et al.,
bioRxiv - Biochemistry 2020
Quote:
... blotted for 5 s and plunge-frozen into liquid ethane using Cryoplunge 3 (Gatan).
-
3',3'-cGAMP (3',3'-cyclic GMP-AMP, Cyclic GMP-AMP, cGAMP) activates the endoplasmic reticulum...
Cat# S7905, SKU# S7905-1mg,
1mg, $390.00
Ask
Masayoshi Nagai, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 1 mM dibutyryl cyclic AMP (Selleck Chemicals S7858) and 2 ng/ml Recombinant Human GDNF (Peprotech 450-10).
-
No products found
because this supplier's products are not listed.
Davide De Forni, et al.,
bioRxiv - Microbiology 2021
Quote:
... and an ELISA assay (SARS-CoV-2 Nucleocapsid Detection ELISA Kit, Sino Biological) was performed to measure produced virus through the quantification of the viral NP nucleoprotein (a measure of viral replication capacity).
-
No products found
because this supplier's products are not listed.
Elisa T. Granato, Kevin R. Foster,
bioRxiv - Microbiology 2020
Quote:
... and placed onto a 5 cm diameter glass bottom Petri dish with a 3-cm diameter uncoated n°1.5 glass window (MatTek Corporation), which was then inverted to allow immediate imaging of the spots through air ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jérémy Dufloo, et al.,
bioRxiv - Microbiology 2024
Quote:
... Correct insertion was checked by colony PCR using vector-specific primers (Forward: 5’-GAGAACCCACTGCTTACTGGC-3’; Reverse: 5’-AGGGTCAAGGAAGGCACG-3’) and the NZYTaq II 2x Green Master Mix (NZYtech). Plasmids with correct insertions were checked by Sanger (Eurofins ...
-
No products found
because this supplier's products are not listed.
Luke A Johnson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... In all patients a directional “1-3-3-1” electrode was used (4/5 patients: Abbott Infinity model 6172 ...
-
No products found
because this supplier's products are not listed.
Juan Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sulfo-Cyanine 3 Azide (2-5 uM final, Lumiprobe, #D1330), and fresh Sodium Ascorbate (100 mM final ...
-
No products found
because this supplier's products are not listed.
Rebecca J. Edgar, et al.,
bioRxiv - Microbiology 2019
Quote:
... 32 using the AmpliteTM Fluorimetric sn-Glycerol-3-Phosphate (Gro-3-P) Assay Kit (AAT Bioquest). GAC was released from cell wall by sequential digestion with mutanolysin hydrolase and PlyC amidase ...
-
No products found
because this supplier's products are not listed.
Shanna H. Coop, Jacob L. Yates, Jude F Mitchell,
bioRxiv - Neuroscience 2022
Quote:
... We inserted tungsten 2.5- to 5-MΩ electrodes (1-3 FHC) that were mounted onto a lightweight screw micro-drive (Crist Instrument ...
-
No products found
because this supplier's products are not listed.
Michael T.S. Girling, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
The MethylFlash Global DNA Methylation (5-mC) ELISA Easy Kit (Epigentek, USA), utilising a colourimetric assay ...
-
No products found
because this supplier's products are not listed.
Qingwen Qian, et al.,
bioRxiv - Physiology 2022
Quote:
... were measured using commercially available ELISA kits (TSH ELISA kit, G-Biosciences, Cat No. IT6045; free T3 ELISA kit, G-Biosciences, Cat No. IT5691; T4 ELISA kit, G-Biosciences, Cat No ...
-
No products found
because this supplier's products are not listed.
Ziyi Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Add 100 μL Working Biotin Conjugate Antibody (Rat IL-6 ELISA Kit, RK00020; Rat IL-1β ELISA Kit, RK00009; Rat IL-10 ELISA Kit, RK00050, Abclonal, China) in each well ...
-
No products found
because this supplier's products are not listed.
Aathira Gopinath, et al.,
bioRxiv - Biophysics 2023
Quote:
... 1-oxyl2,2,5,5-tetramethyl-3-pyrroline-3-methyl methanethiosulfonate (MTSL, Toronto Research Chemicals) and kept stirring at room temperature for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Huyen Thi Lam Nguyen, et al.,
bioRxiv - Systems Biology 2022
Quote:
... a MACH 3 Rabbit HRP Polymer Detection kit (Biocare Medical # M3R531H) or a MACH 3 Mouse HRP Polymer Detection kit (Biocare Medical # M3M530H ...
-
No products found
because this supplier's products are not listed.
Ling Bai, et al.,
bioRxiv - Physiology 2021
Quote:
... Exendin-3 (ApexBio, B6943) 10 ug/mouse in saline.
-
No products found
because this supplier's products are not listed.
Donatas Repecka, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and MultiQuant 3 (Sciex) was used for analysis and quantitation of results ...
-
No products found
because this supplier's products are not listed.
Valerie Y. Odeh-Couvertier, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 μL of 100/3 mM DSS-D6 in deuterium oxide (Cambridge Isotope Laboratories) were added to 1.7 mm NMR tubes (Bruker BioSpin) ...
-
No products found
because this supplier's products are not listed.
Ross Peterson, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
A Sandwich ELISA (Bovine Lactoferrin ELISA kit, NBP3-12185, Novus Biologicals) was used and adopted to determine bovine lactoferrin concentrations in rat serum ...
-
No products found
because this supplier's products are not listed.
Laura M. Canaday, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IL-8) (Meso Scale Discovery) and the DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA (PBL Assay Science) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yoichi Araki, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or Spinning disk confocal microscopes controlled by axiovision software (Carl Zeiss; Fig. 2, 3, and 5). Following 5-10 min of baseline recording ...
-
No products found
because this supplier's products are not listed.
Tori Tonn, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... glass slides (4’’ by 3’’; Ted Pella) and the feature-side of the PDMS slabs were thoroughly cleaned with tape to remove any dust particles ...
-
No products found
because this supplier's products are not listed.
Silvana Valtcheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Nanoject III (Drummond Scientific, Item# 3-000-207) was used for AuCx ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Pranay Shah, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 3 μM of CHIR99021 (Cambridge Bioscience, SM13-5) and 10 μM of Y-27632 ...
-
No products found
because this supplier's products are not listed.
Michael Fairhead, et al.,
bioRxiv - Biochemistry 2019
Quote:
... in Swissci 3 well sitting drop plates (Molecular Dimensions). Crystals appeared in several conditions over 4-7 days ...
-
No products found
because this supplier's products are not listed.
Alina Sultanova, et al.,
bioRxiv - Immunology 2020
Quote:
... 3 and 5 were obtained from Abnova (Taipei, Taiwan). The proteins were produced in vitro using wheat germ expression system which preserves native protein folding.
-
No products found
because this supplier's products are not listed.
Rebecca A. MacPherson, et al.,
bioRxiv - Genomics 2022
Quote:
... We used 2μL of the resulting DNA mixture in a PCR reaction with primers (Left: 5’-CTAGCACGGAACCCTGGAAAT -3’; Right: 5’-GCAGCGCCTAGTAATCACAGA -3’) according to ApexRedTaq (Genesee Scientific, El Cajon, CA) manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62; Tocris and HelloBio); D-AP5 (HelloBio) ...
-
No products found
because this supplier's products are not listed.
Chiara Battistini, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... sh-C (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-c); sh-E (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-e) or with the scrambled control (CSHCTR001-LVRU6GP, Genecopoeia), and the following packaging vectors ...
-
No products found
because this supplier's products are not listed.
Michael Westberg, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Sitting drops were dispensed on Intelli-plates 96-3 LVR (Hampton Research) using an Oryx8 crystallization robot (Douglas Instruments) ...
-
No products found
because this supplier's products are not listed.
Ligia B. Schmitd, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mice were anesthetized with isoflurane (5% induction, 2-3% maintenance, SomnoSuite Kent Scientific) 10d after the first SNC and the crush placed immediately proximal to the first one ...
-
No products found
because this supplier's products are not listed.
Tiechao Ruan, et al.,
bioRxiv - Genetics 2024
Quote:
... was isolated from fresh spermatozoa from the WT mice (n=3) and the Iqch KO mice (n=3) using the RNAsimple Total RNA Kit (Tiangen Biotech, China, 4992858). A Ribo-Zero™ rRNA Removal Kit (MRZPL1224 ...
-
No products found
because this supplier's products are not listed.
Chatterjee Amit, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Syntaxin 3 (Synaptic system 110032). Each antibody was 1000-fold diluted in either 5% (w/v ...
-
No products found
because this supplier's products are not listed.
Subhas C. Bera, et al.,
bioRxiv - Biophysics 2021
Quote:
... Model 3 includes dissociation from RPI and is solved in the context of three assumptions for which we have an analytical solution ...
-
No products found
because this supplier's products are not listed.
Bianca Maria Rotoli, et al.,
bioRxiv - Cell Biology 2019
Quote:
Calu-3 cells (American Type Culture Collection), obtained from a human lung adenocarcinoma and derived from serous cells of proximal bronchial airways ...
-
No products found
because this supplier's products are not listed.
Roland Á. Takács, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 3% bovine serum albumin (BSA) (Amresco, VWR ...
-
No products found
because this supplier's products are not listed.
Iris Lindberg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... via a 30-gauge 10 µL Hamilton syringe (Hamilton 701SN-30/3’/3) mounted on a motorized injector (Stoelting QSI). After each injection ...
-
No products found
because this supplier's products are not listed.
Fabian Ruperti, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... at 6.0 m/s (3 x 30 s, 5 min pause time) using 1.0 mm zirconia/glass beads (Biospec Products, OK, USA). After centrifugation for 10 min at 15,000 x g and 4 °C with a 5415R benchtop microcentrifuge (Eppendorf ...
-
No products found
because this supplier's products are not listed.
Kelsey Voss, et al.,
bioRxiv - Immunology 2021
Quote:
Autoantibodies were measured with ELISA kits purchased from Alpha Diagnostics: Anti-Histone Total Ig ...