-
No products found
because this supplier's products are not listed.
Tayler D. Sheahan, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3 µM (Adooq Bioscience A18250); oxytocin ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Amanda Thomaz, et al.,
bioRxiv - Cancer Biology 2019
Quote:
MB cells were seeded at density of 3×103 cells per well in complete medium into 96-well plates (NEST Biotechnology, Jiangsu, China). After overnight culture in complete medium ...
-
No products found
because this supplier's products are not listed.
Jing Zeng, et al.,
bioRxiv - Genetics 2023
Quote:
... and 100 ng ml-1 Preclinical FMS-like Tyrosine Kinase 3 Ligand (FLT3L) (CellGenix, cat# 1415-050). HSPCs were electroporated with 3xNLS-SpCas9:sgRNA or 3xNLS-HiFi- SpCas9:sgRNA RNP immediately ...
-
No products found
because this supplier's products are not listed.
S. L. Fowler, et al.,
bioRxiv - Neuroscience 2023
Quote:
Pooled EV fractions 4–6 isolated from 0.8 g tissue were diluted 1:5 in PBS containing a 1:3 dilution of 10 nm gold-conjugated BSA (BBI solutions), applied to glow-discharged 2/2 μm holey carbon-coated 200-mesh gold grids (Quantifoil ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Pépin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 3 kcal/g) or high-fat diet (n=16; HFD; Research Diets Inc. ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Noelia Perez Diaz, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... bronchi and parenchyma from naïve rats was measured using Rat PPARβ/δ ELISA kit (Abbkine) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Maureen C. Lamb, et al.,
bioRxiv - Cell Biology 2019
Quote:
... the following primary antibody was used: rabbit anti-GFP 1:2000 (pre-absorbed on yw ovaries at 1:20 and used at 1:100; Torrey Pines Biolabs, Inc., Secaucus, NJ) and rabbit anti-dsRed 1:300 (Clontech ...
-
No products found
because this supplier's products are not listed.
Chan Ho Park, et al.,
bioRxiv - Plant Biology 2022
Quote:
... anti-BSL2/3 (AbFrontier; 1:2,000 dilution), anti-FLAG (Sigma ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Sara F. Costa, et al.,
bioRxiv - Microbiology 2023
Quote:
... One microliter of each sample was mounted on a layer of 1.2% (w/v) agarose in 1:3 (vol/vol) TSB/PBS placed on a glass plate (Bio-Rad Mini-PROTEAN Short Plate) with a coverslip placed on top of each sample ...
-
No products found
because this supplier's products are not listed.
Safwan K. Elkhatib, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... and plasma were assessed using 3-CAT research ELISA (Rocky Mountain Diagnostics, BAE-5600, Colorado Springs, CO, USA) which had a corrected NE lower limit of detection of 30 pg/mL ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were washed 3 times and incubated with 100 μL HRP-conjugated anti-mouse IgG secondary antibody (L20/01; HyTest; 1:25000) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Kento T. Abe, et al.,
bioRxiv - Immunology 2020
Quote:
... plate blocking was performed with 3% w/v milk powder (BioShop Canada Inc., #ALB005.250, lot #9H61718) in PBS for 1–2 hr.
-
No products found
because this supplier's products are not listed.
Pavel A. Nikitin, et al.,
bioRxiv - Immunology 2022
Quote:
... Plates were washed 3 times with endotoxin-free GVB buffer with Ca2+ and Mg2+ (GVB++, Complement Technology) and incubated with normal human serum (Complement Technology ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Yiwei Liu, et al.,
bioRxiv - Microbiology 2023
Quote:
... They were either combined at a 1 : 1 ratio or separately subjected to 3% H2O2 (Spectrum Chemical) and incubated at 37°C with 200rpm shaking for up to 2h ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Otto Kauko, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Antibodies to Tcf4 (Clone 6H5-3 Exalpha Biologicals), β-catenin (Rabbit Polyclonal Antibody ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Wren E. Michaels, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Cell lysates were prepared and diluted to 3 mg/ml using the sample preparation kit (Protein Simple) for an automated capillary western blot system ...
-
No products found
because this supplier's products are not listed.
Elliot Campbell, et al.,
bioRxiv - Immunology 2023
Quote:
... Antibody levels specific to Delta variant RBD were assessed in mouse sera by direct ELISA: plates were coated with 1 μg/ml Delta variant RBD (#S951-100, Leinco Technologies, Inc.) or MT-001 diluted in PBS and incubated at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Philip Jean-Richard-dit-Bressel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The center of the right side-wall included a recess (5 x 3 x 15 cm) that housed a magazine dish (3 cm diameter) into which 45mg grain pellets (Bio-Serv, NJ, USA) were delivered ...
-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Histological analysis was performed on thoracic spines fixed in 10% neutral-buffered formalin for 3 days at room temperature followed by 1-week decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Amit Rahi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... followed by incubation for 5 min and intermittent washing with 3 chamber volumes of buffer B: PLL PEG biotin (0.1 mg ml-1, Susos, AG), Streptavidin (0.625 mg ml-1 ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Swarna L. Vijayaraj, et al.,
bioRxiv - Immunology 2021
Quote:
... Ubiquitination assays were performed at 37 °C for 90 minutes using loaded E1 (~ 80 ng, 3 μl, Boston Biochem kit, K-995), E2 (1 μM ...
-
No products found
because this supplier's products are not listed.
Teodors Pantelejevs, Marko Hyvönen,
bioRxiv - Biochemistry 2022
Quote:
... lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), after which column matrix was washed with 10 CV Nickel Buffer A ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Holly Linley, et al.,
bioRxiv - Immunology 2022
Quote:
... placed in 3 µm transwell inserts with 10 µg/ml anti-CD200R1 (OX131, Absolute Antibody), or rat IgG1 isotype control (eBioscience ...
-
No products found
because this supplier's products are not listed.
Elisa Maritan, et al.,
bioRxiv - Microbiology 2022
Quote:
... and sputter-coated with 3 nm of platinum (Q150T ES, Quorum Technologies Ltd, Ringmer, UK). Alternatively ...
-
No products found
because this supplier's products are not listed.
Franziska Hentzschel, et al.,
bioRxiv - Microbiology 2023
Quote:
... the salivary gland sporozoite suspension was topped up to 1 ml with RPM and then carefully underlaid with 3 ml of 17 % Accudenz (in dH2O, Accurate Chemical & Scientific Corp., Westbury, NY, USA). Centrifugation for 20 min at 2800 rpm and at room temperature without break separated sporozoites from cell debris ...
-
No products found
because this supplier's products are not listed.
Ashley Kidwell, et al.,
bioRxiv - Physiology 2021
Quote:
... Y-3 hybridoma cells (ATCC HB-176) were incubated in a membrane cell culture flask following the manufacturer’s instructions (Wheaton CELLine Bioreactor Flask and Hybridoma-SFM ThermoFisher 12045076) ...
-
No products found
because this supplier's products are not listed.
Samual C. Allgood, et al.,
bioRxiv - Microbiology 2023
Quote:
... glass-bottomed plates (Brooks Life Sciences catalog number MGB096-1-2-LG-L) at 37°C with 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Anita K. Nivedha, et al.,
bioRxiv - Biophysics 2021
Quote:
... 96-well white plates (BrandTech). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Charneal L. Dixon, et al.,
bioRxiv - Immunology 2023
Quote:
... cDNA was synthesized from 1 µg RNA using SensiFAST cDNA Synthesis Kit (FroggaBio; Concord, Canada). qPCR was performed using a QuantStudio™ 7 Flex Real-Time PCR System in conjunction with a SybrGreen System (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Adam S Hassan, et al.,
bioRxiv - Immunology 2019
Quote:
... plates were washed three times with phosphate buffered saline (PBS: Wisent Bioproducts) and replaced in the incubator with DMEM-FBS containing 50 μg/mL gentamicin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Mark A. Arick II, et al.,
bioRxiv - Genomics 2022
Quote:
A Hi-C library also was prepared using 100 μL of Rohu-1 blood with the Proximo Hi-C Animal Kit (Phase Genomics, Seattle, WA, USA). The final Hi-C DNA-Seq library was submitted to Novogene (www.en.novogene.com ...
-
No products found
because this supplier's products are not listed.
Kenneth H. Hu, et al.,
bioRxiv - Genomics 2020
Quote:
The Thunder-Link Plus kit (Expedeon) was used to conjugate the amine modified anchor strand to an anti-mCD45 antibody (clone 30F-110 ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Sergej Franz, et al.,
bioRxiv - Microbiology 2020
Quote:
... AP1153a, Abcepta, 1:500), rabbit anti-CHIKV antiserum (IBT Bioservices, 1:10,000) or mouse anti-p24 (ExBio, 1:1000). Secondary antibodies conjugated to Alexa680/800 fluorescent dyes were used for detection and quantification by Odyssey Infrared Imaging System (LI-COR Biosciences).