1 - 50 of 553
suppliers found for
3' 3' Cyclic GAMP cGAMP ELISA Kit 5 Plate
» view 10000+ matched products-
Arbor Assays Sponsored
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay KitCat# K073-H5, 1.0 ea, USD $1875.0 Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Evolutionary Biology 2018, published in G3 (Bethesda, Md.) doi: 10.1534/g3.118.200413Quote: ... 8-Bromoadenosine 3’,5’-cyclic monophosphate [8-Br-cAMP] (Sigma), 3-isobutyl-1-methylxanthine [IBMX] (Sigma) ... -
Thermo Fisher
No products found because this supplier's products are not listed.Cited in iRhom2 serves as a facilitator in obesity by enhancing adipose inflammation and insulin resistancebioRxiv - Pathology 2019Quote: ... The MCP-3 (Cat#: BMS6006INST) ELISA kit were from Invitrogen. The GCP-2 (Cat# ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Physiology 2018, published in Frontiers in Physiology doi: 10.3389/fphys.2019.00556Quote: ... 5’-ATCGAGTGCGATCACAAGCAG-3’ (1st PCR) and 5’-ACTCTCAGATTCCGGATTCACC-3’ (2nd PCR) using 5’-Full RACE Kit (TAKARA). For the 3’ RACE ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Genomics 2019, published in Journal of Virology doi: 10.1128/JVI.02007-19Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ... -
Addgene
No products found because this supplier's products are not listed.Cited in GTSE1 tunes microtubule stability for chromosome alignment and segregation through MCAK inhibitionbioRxiv - Cell Biology 2016, published in The Journal of Cell Biology doi: 10.1083/jcb.201606081Quote: ... (5’-CACCGAAGGCCAGAGCAGCGCCGGC-3’ and 5’-AAACGCCGGCGCTGCTCTGGCCTTC-3’) and (5’-CACCGGCAGGCTGAAGGCTCATCG-3’ and 5’-AAACCGATGAGCCTTCAGCCTGCC-3’)into the pX330 background (from Addgene), as described in(Ran et al. ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83). -
Promega
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019, published in Molecular Immunology doi: 10.1016/j.molimm.2019.06.001Quote: ... RAC2 3’UTR-: 5’-TTGCGGCCAGCGGCCGCTCTCCAAACTTGAATCAATAAATTT-3’ and inserted into a dual luciferase psiCHECK2 backbone (Promega). RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2017, published in Nature Communications doi: 10.1038/s41467-018-04402-6Quote: ... was amplified from zebrafish wildtype genomic DNA with primers 5’-GCTTATACGCACGACTGC-3’ (forward) and 5’-TGTGTCGATCGCGTATCGC-3’ (reverse) with the Expand Hi-Fidelity PCR kit (Roche). The 3242 bp upstream region of tbx1 was TOPO-cloned into the pENTR™ 5’-TOPO® TA Cloning® plasmid (Cat#59120 ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019, published in Journal of Immunology and Regenerative Medicine doi: 10.1016/j.regen.2020.100030Quote: 3 60mm plates (Corning, CLS430166) of Day 9 hiPSC-NPCs were mixed and pumped through anti-SSEA-5 and isotype control functionalized GEDI chips at 1ml/hr for 30 min ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in Biological Psychiatry doi: 10.1016/j.biopsych.2018.12.013Quote: Cyclic AMP (cAMP) levels were measured using the Cyclic AMP Complete ELISA Kit (AbCam, ab133051, Cambridge, MA) following instructions from the manufacturer ... -
Agilent
No products found because this supplier's products are not listed.Cited in Spermatoproteasome-deficient mice are proficient in meiotic DNA repair but defective in meiotic exitbioRxiv - Cell Biology 2018Quote: ... with primers flanking exons 1 and intron 1 (Primer F 5-CTTCTCGGTATGACAGGGCAATC-3’ and R 5’-ACTCTACCTCCACTGCCAACCTG-3’) and either direct sequenced or subcloned into pBlueScript (Stratagene) followed by Sanger sequencing ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2017, published in Acta Biochimica et Biophysica Sinica doi: 10.1093/abbs/gmy017Quote: ... Adamts-5 and Mmp-3 in cell culture supernatants was measured using ELISA kits (R&D Systems, Minneapoils, MN, USA) according to the manufacturer’s instructions. -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019Quote: ... cyanine 3 and cyanine 5 (Perkin Elmer). The ACD 3-plex negative control probe was run in parallel on separate sections in each experiment to assess the background level and set the acquisition parameter ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2019, published in PLOS ONE doi: 10.1371/journal.pone.0222685Quote: ... The plates were washed 3 times using PBST and then developed using an ELISA developing kit (BD Biosciences). The optical densities at 450 nm were read using an ELISA plate reader (Molecular Devices). -
Peprotech
No products found because this supplier's products are not listed.Cited in In Vitro Assay for the Detection of Network Connectivity in Embryonic Stem Cell-Derived CulturesbioRxiv - Bioengineering 2018Quote: ... and 5 ng/mL neurotrophin-3 (NT-3; Peprotech #450-03). After 24 hours ... -
Merck
No products found because this supplier's products are not listed.Cited in Oxylipin metabolism is controlled by mitochondrial β-oxidation during bacterial inflammationbioRxiv - Biochemistry 2020Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ... -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019Quote: ... cGMP concentration was determined using Cyclic GMP ELISA Kit (Cayman chemical) according the manufacture’s protocol. -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: A cleaved caspase 3 ELISA (Cell Signaling Technology, Danvers, MA) was done according to manufacturer’s instructions. -
Biotek
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0216104Quote: ... with Take 3 Micro-Volume Plates (BioTek, Winooski, VT) and Gen5 Microplate Reader and Imager Software (BioTek ... -
Molecular Devices
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019, published in PeerJ doi: 10.7717/peerj.7733Quote: ... Plates were read using a Flexstation 3 (Molecular Devices) plate reader at 37 °C ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2017Quote: ... 3 mM 3-mercaptopicolinic acid (3-MPA, Santa Cruz) was used to inhibit endogenous glucose production ... -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2020, published in Development doi: 10.1242/dev.194415Quote: ... day 3 hPSC-derived NMP-like cells were dissociated using Accutase and re-plated at a density of 37,500-86,000 cells /cm2 on Geltrex (Thermo Fisher)-coated plates directly in N2B27 containing CHIR99021 (3 µM, Tocris) and FGF2 (100 ng/ml ... -
Greiner
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019, published in Cell Reports doi: 10.1016/j.celrep.2019.08.050Quote: ... ELISA plates (Greiner) were coated with 5μg/mL anti-CD3/28 with the final volume of 100μL at 4°C for overnight ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ... -
Enzo Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... 0.5mM adenosine 3’,5’-cyclic monophosphate (cAMP, Enzo Life Science), 2ng/ml transforming growth factor beta 3 (TGFβ3 ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... were taken on day 1 and 3 and analyzed for TGFβ using ELISA assay (BioLegend) and IFNγ and TNFα using a multiplex-bead based assay (Meso Scale Discovery ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020, published in Molecular Cell doi: 10.1016/j.molcel.2020.08.017Quote: ... 3 -diaminobenzidine (DAB) kit (Vector Labs) was applied to visualize the signal ... -
Eurogentec
No products found because this supplier's products are not listed.Cited in Visualising G-quadruplex DNA dynamics in live cells by fluorescence lifetime imaging microscopybioRxiv - Biophysics 2020Quote: ... Oligonucleotides (c-Myc and ds26; sequences = 5’-TGAGGGTGGGTAGGGTGGGTAA-3’ and 5’-CAATCGGATCGAATTCGATCCGATTG-3’, respectively) were purchased from Eurogentec, and dissolved in 10 mM lithium cacodylate buffer at pH 7.3 ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... was amplified by PCR using the primers (5’-GGTTCCGCGTGGATCCATGTCTCATGCAGCCGAGCCA-3’ and 5’-GGAATTCCGGGGATCCTCAGGACTCCTCTTCAATGCTGA-3’) and cloned into BamHI site of pGEX-4T-1 expression vector (GE Healthcare) using In-Fusion HD Cloning System (Clontech) ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2017, published in eLife doi: 10.7554/eLife.24350Quote: ... and Cholesterol in a molar ratio of 3:3:1 to a final lipid concentration of 5 mg/ml (Avanti Polar Lipids, Inc). The lipid bilayer was further supplemented with 0.03 mol% DiD (Molecular Probes ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2021Quote: ... Plates were pre-coated with coated with 3 μg/ml of vitronectin (07180, Stemcell Technologies) and 5mg/mL Col IV (C7521-5MG ... -
Zymo Research
No products found because this supplier's products are not listed.bioRxiv - Genomics 2017, published in Cell doi: 10.1016/j.cell.2017.10.019Quote: Total RNA from 3–5 day old adult fly heads was extracted using MiniPrep kit (Zymo Research, R1054). Complementary DNA was synthesized using an oligo-dT primer ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2016Quote: ... or 5 mM 3-methyladenine (Calbiochem®, Merck Millipore, 189490), and dissected as third instar larvae. -
Lucigen
No products found because this supplier's products are not listed.Cited in Expression of the miR-302/367 microRNA cluster is regulated by a conserved long non-coding host genebioRxiv - Genetics 2018Quote: Rapid Amplification of cDNA Ends (RACE) for the 5’ and 3’ ends was performed using ExactSTART™ Eukaryotic mRNA 5′- & 3′-RACE Kit (Epicentre). For 5’-RACE “mmiR-302 t Rev4” was used as reverse and internal primer ... -
Eppendorf
No products found because this supplier's products are not listed.bioRxiv - Immunology 2018Quote: ... and 0.4 U 5′-3′ RNase Inhibitor (Eppendorf)) and immediately frozen on dry ice ... -
Phenomenex
No products found because this supplier's products are not listed.bioRxiv - Systems Biology 2018, published in Journal of Proteome Research doi: 10.1021/acs.jproteome.8b00166Quote: ... with 3 cm of 5 μm Aqua C18 resin (Phenomenex, 00G-4299-E0) followed by 3 cm of Partisphere strong cation exchange (SCX ... -
Axon Medchem
![ADAMTS-5 inhibitor - CAS [929634-33-3], 100%](https://image.labshake.com/supplier-product/305cc4ba-a97e-4815-88b6-a95430b03ef4/80035787-6648-42ea-ba04-55f314fb6e3d.png)
ADAMTS-5 inhibitor Sold for research purposes only.Cat# 2083.0, SKU# 2083-5 mg, 5mg, US $148.50 / EA, EURO, €135 / EA AskbioRxiv - Developmental Biology 2018, published in Cell Stem Cell doi: 10.1016/j.stem.2018.07.004Quote: ... CHIR99021 (3 μM; Axon Medchem), PD0325901 (PD ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.Cited in Argininosuccinic aciduria fosters neuronal nitrosative stress reversed by Asl gene transferbioRxiv - Genetics 2018, published in Nature Communications doi: 10.1038/s41467-018-05972-1Quote: ... 5’-GGTTCTTGGTGCTCATGGAT-3’ (sense), 5’-GCCAGAGGCCACTTGTGTAG-3’ (WT, antisense) and 5’-CATGACAGCTCCCATGAAGA-3’ (AslNeo/Neo mice, antisense) provided by Jackson Laboratory (Bar Harbor, ME). Amplification conditions were 95°C for 10 minutes then 40 cycles of 94°C for 30 seconds ... -
GenScript
No products found because this supplier's products are not listed.Cited in TAK1 Regulates Endothelial Integrity Through Stabilization of Junctions via GSK3β and FoxO1bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ). -
VWR
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2017, published in Nature Communications doi: 10.1038/s41467-018-03045-xQuote: ... 3 mM phosphoenolpyruvate (VWR), 8 U lactate dehydrogenase (Roche) ... -
Sutter Instruments
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2018, published in Oncogene doi: 10.1038/s41388-019-0709-6Quote: ... Patch electrodes with resistances of 3-5 MΩ were pulled from borosilicate micropipettes (Sutter Instrument) and filled with a pipette solution containing (in mM) ... -
Polysciences
No products found because this supplier's products are not listed.bioRxiv - Pathology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0220483Quote: ... Sections were washed with PBS/5% goat serum 3 times for 3 minutes each and fixed with Aqua-Mount (Polysciences, Warrington, PA). Control kidney sections lacked primary antibodies. -
Beckman
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: ... 3 and 5 and counted using a particle counter (Z1; Beckman Coulter, Inc.). Experiments were carried out in triplicate ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0215341Quote: Purified RNA was stained with cyanine 3 or cyanine 5 using the ULS Fluorescent Labeling Kit for Agilent arrays from Kreatech (Leica Biosystems, Amsterdam, Netherlands) according to the manufacturer’s instructions ... -
World Precision Instruments
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in The Journal of Neuroscience doi: 10.1523/jneurosci.0168-19.2019Quote: ... 3-5 MΩ borosilicate glass pipettes (WPI) were filled with internal solution containing ... -
Alpco Diagnostics
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... frozen plasma was thawed on ice and 5 uL/sample loaded in duplicate wells onto a 96 well plate in Mouse Ultrasensitive Insulin ELISA kit from ALPCO® ... -
Jackson ImmunoResearch
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2019Quote: ... and blocking for 30 min in 3 to 5 % Bovine Serum Albumin (Jackson ImmunoResearch, West Grove, PA, USA) or 10 % goat serum in phosphate-buffered saline with 0.05 to 0.1% Triton-X 100 ...