-
No products found
because this supplier's products are not listed.
Chen Gong, Gerald B. Koudelka,
bioRxiv - Microbiology 2023
Quote:
... template DNA used to transcribe 16S rRNA was PCR amplified from genomic DNA of MG1655 strain purified by regular phenol-chloroform extraction and ethanol precipitation using the Taq KeenGreen 2x Master Mix (IBI Scientific, U.S.) and the primer set EC16f_t7 and EC16r (75) ...
-
No products found
because this supplier's products are not listed.
Yuan Xue, Ido Braslavsky, Stephen R. Quake,
bioRxiv - Biochemistry 2021
Quote:
... Reaction master mix and polymerase were separately equilibrated to −19°C on a TropiCoolerTM (Boekel Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Alex L. Yenkin, et al.,
bioRxiv - Genomics 2021
Quote:
... The second amplification uses the cleaned template and BioLine MyTaq HS Red Mix 2x (C755G97,Meridian Life Sciences, Memphis, TN, USA), according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Min-Ting Lee, Henry H. Le, Elizabeth L. Johnson,
bioRxiv - Microbiology 2020
Quote:
... Barcoded forward and nonbarcoded reverse primers were used with Taq DNA polymerase Master Mix (TONBO biosciences, CA) according to the manufacturer’s directions ...
-
No products found
because this supplier's products are not listed.
Louise Huot, et al.,
bioRxiv - Genomics 2019
Quote:
... 1.25 µL of sample containing 50 ng/µL of cDNA and 1.75 µL of Master mix containing 0.85 µM of primers were distributed in multiwell plates by the Echo 525 liquid handler (Labcyte). After an enzyme activation step of 95°C for 15 min ...
-
No products found
because this supplier's products are not listed.
Leanne E. Wybenga-Groot, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 mM Na3VO4) at rt for 5-10 min before addition of master mix (42 pmol E1 (UBE1, Boston Biochem or Ubiquitin-Proteasome Biotechnologies) ...
-
No products found
because this supplier's products are not listed.
Camilla Schinner, et al.,
bioRxiv - Cell Biology 2021
Quote:
... with 2x gentamicin/amphotericin B (CELLnTEC, Bern, Switzerland) over night at 4 °C ...
-
No products found
because this supplier's products are not listed.
Chathura Wijesinghege, et al.,
bioRxiv - Plant Biology 2022
Quote:
... run on a Bio-Rad T100 Thermal Cycler (Hercules, CA, USA) with a PCR Master mix Solution i-MAX II (iNtRON Biotechnology, S Korea). PCR products were separated on a 1% agarose gel.
-
No products found
because this supplier's products are not listed.
Ulrich Dobramysl, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mNeon green was amplified from pNCS mNeon green (Allele Biotech) with primers GCTTCGAGCTCATCGATGGTGAGCAAGGGCGAGGAGGATA ACATGGCCTC and ATCAGGGATCACTTGTACAGCTCGTCCATGCCCATC.
-
No products found
because this supplier's products are not listed.
Du-Hwa Lee, et al.,
bioRxiv - Plant Biology 2022
Quote:
... RealHelixTM qPCR kit (NANOHELIX; Korea), and the StepOnePlus Realtime PCR System (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Jorge Ibañez-Vega, et al.,
bioRxiv - Cell Biology 2020
Quote:
... ~2x 107 3-μm latex NH2-beads (Polyscience, Eppelheim, Germany) were activated with 8% glutaraldehyde for four h at room temperature ...
-
No products found
because this supplier's products are not listed.
Brian E. Krumm, et al.,
bioRxiv - Biophysics 2022
Quote:
... 50 μL well-1 of 2X neurotensin 1-13 (Tocris) solutions were added to the appropriate well and incubated for an additional 30 min ...
-
No products found
because this supplier's products are not listed.
Andrea Walens, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... tumor lysates were made in 2X lysis buffer (RayBiotech, Norcross, GA) and diluted to 50 μg per 100 μL in diluent provided ...
-
No products found
because this supplier's products are not listed.
Bart Coppens, et al.,
bioRxiv - Microbiology 2022
Quote:
... green fluorescent aminated (radius = 50 nm) or green fluorescent carboxylated (radius = 60 nm) polystyrene nanoparticles (Spherotech) were gently pipetted directly below the liquid-air interface to avoid structural disturbance of the biofilms ...
-
No products found
because this supplier's products are not listed.
Alejandro Méndez-Mancilla, et al.,
bioRxiv - Bioengineering 2021
Quote:
... washed 2X in Dulbecco’s PBS without calcium or magnesium (D-PBS, Caisson Labs) and resuspended in 20 μl P3 Primary Cell Nucleofector Solution (Lonza V4XP-3032) ...
-
No products found
because this supplier's products are not listed.
Liliana M. Sanmarco, et al.,
bioRxiv - Immunology 2023
Quote:
... Plates were washed 2X with 0.05% Tween in 1X PBS (Boston BioProducts, #IBB-171X) and blocked with 1% BSA in 1X PBS (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Abbigayl E.C. Burtis, et al.,
bioRxiv - Immunology 2024
Quote:
... Cells were washed 2x with PBS containing 2% FBS (Atlas Biologicals, Fort Collins, CO). Viable T cells were enriched using the Easy Sep T cell isolation Kit followed by the Easy Sep Dead Cell removal Kit (Stem Cell Technologies ...
-
No products found
because this supplier's products are not listed.
Juan Jesus Vicente, et al.,
bioRxiv - Cell Biology 2024
Quote:
... then washed 2x with same buffer except NP-40 replaced by 1% PPS detergent (Expedeon). Immunoprecipitated complexes were released from beads with 0.2 M acetic acid and dried.
-
No products found
because this supplier's products are not listed.
Vineet Choudhary, et al.,
bioRxiv - Cell Biology 2020
Quote:
... an amino acid mix (United States Biologicals), containing either 2% glucose ...
-
No products found
because this supplier's products are not listed.
Sathish Ramakrishnan, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Calcium Green conjugated to a lipophilic 24-carbon alkyl chain (Calcium Green C24) was custom synthesized by Marker Gene Technologies (Eugene, OR)
-
No products found
because this supplier's products are not listed.
Ray X. Lee, Greg J. Stephens, Bernd Kuhn,
bioRxiv - Neuroscience 2019
Quote:
... and a Gummy Bone (Petite, Green; Bio-Serv, Inc.), after trauma induction (ParObsIsoEE mice ...
-
No products found
because this supplier's products are not listed.
Yamato Goto, Seigo Iwata, Eijiro Miyako,
bioRxiv - Bioengineering 2022
Quote:
... indocyanine green (ICG, 1 mg/mL; Tokyo Chemical Industry) was dissolved in PBS with 5% cremophor EL (Nacalai Tesque ...
-
No products found
because this supplier's products are not listed.
Mike R. Schlabach, et al.,
bioRxiv - Immunology 2023
Quote:
... Ribonucleoprotein (RNP) master mixes containing Cas9 protein (Aldevron, Cat#9212) and u728 sgRNA or a7mm OLF sgRNA were added to the cell suspension and transferred to processing assembly (MaxCyte) ...
-
No products found
because this supplier's products are not listed.
Manthan Patel, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The dot blots were then incubated with 50 μl of rabbit polyclonal anti-CGGBP1 antibody mix (a mix of 1:120 dilutions of SC-292517, SCBT and 10716-1-AP, Proteintech) overnight with gentle rocking ...
-
No products found
because this supplier's products are not listed.
Sevan N. Alwan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... each sample then was placed in 2 ml tubes of Lysin Matrix Tubes containing 1.4 mm ceramic spheres and then homogenized 2x using Beadbeater homogenizer (Biospec, USA) for 45 seconds ...
-
No products found
because this supplier's products are not listed.
Joseph S Bowness, et al.,
bioRxiv - Genomics 2023
Quote:
ProteinA magnetic Dynabeads (40 μl per sample) were blocked in Chromatin IP buffer (Shearing Buffer D3 diluted with 2X Covaris truChIP IP Buffer and supplemented with 1X Protease Inhibitor Cocktail ...
-
No products found
because this supplier's products are not listed.
Bente Rackow, et al.,
bioRxiv - Microbiology 2024
Quote:
... Whole genome sequencing using the Illumina NovaSeq platform with a read length of 2x 150 bp was performed by GENEWIZ Germany ...
-
No products found
because this supplier's products are not listed.
Chunmei Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... A mix of 125 ng/μl Cas9 mRNA (System Biosciences), 12.5 μM gRNA (IDT) ...
-
No products found
because this supplier's products are not listed.
Prerna Bhargava, et al.,
bioRxiv - Cell Biology 2023
Quote:
Phagocytic activity was measured using the green E.coli assay kit from BioVision. Both macrophage cell lines were incubated with green E.coli diluted to 1 % in media for 2 h at 37◦ C and the cells were harvested following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Esteban Flores, et al.,
bioRxiv - Microbiology 2023
Quote:
African green monkey kidney Vero cells (CCL-81, ATCC, distributed by Cedarlane Laboratories Ltd. ...
-
No products found
because this supplier's products are not listed.
Pietro Mesirca, et al.,
bioRxiv - Cell Biology 2020
Quote:
1×106 MDSC resuspended in 0.2 ml of 1/2X matrigel in HBSS were injected subcutaneously into the back of n=4 8-week-old SCID/beige mice (Charles River). Follow up observation was carried out for up to 4 months ...
-
No products found
because this supplier's products are not listed.
Firat Terzi, Johannes Knabbe, Sidney B. Cambridge,
bioRxiv - Neuroscience 2021
Quote:
... 4×106 HEK293T cells/cm² were plated in ten 15 cm Ø cell culture dishes and were grown in Dulbecco's Modified Eagle Medium containing 2x MEM NEAA (PAN Biotech), and Penicillin-Streptomycin (100 U/mL ...
-
No products found
because this supplier's products are not listed.
Elinor Lee, et al.,
bioRxiv - Physiology 2022
Quote:
... a 13 lipid class Lipidyzer Internal Standard Mix (AB Sciex, 5040156) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Artyom Luzhin, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and then stained with Vista Green (Cell Biolabs, San Diego, CA, cat # 235005) diluted 1:10,000 in TE buffer ...
-
No products found
Christiane Iserman, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The mix was incubated in 384-well plates (Cellvis P384-1.5H-N) for 16 hours at 37°C unless indicated otherwise ...
-
No products found
because this supplier's products are not listed.
Daisuke Oikawa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... a 10:1 mix of the 4H8 WH2 (Adipogen, AG-20B-0008) and 3C8 (eBiosciences ...
-
No products found
because this supplier's products are not listed.
TP Prescott, K Zhu, M Zhao, RE Baker,
bioRxiv - Biophysics 2021
Quote:
... FNC Coating Mix was purchased from Athena Enzyme Systems (Baltimore, MD, USA). Dow Corning high-vacuum grease was purchased from ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Julia Bär, et al.,
bioRxiv - Cell Biology 2021
Quote:
... A mix of 20 μM of porcine brain tubulin protein (Cytoskeleton/Tebu-Bio) with 1 mM GMPCPP (Jena Bioscience ...
-
The 5-FAM (Green) Collagen Hybridizing Peptide (CHP) is a synthetic peptide that can...
Cat# 5264-60UG,
0.3 mg, USD $290.0
Ask
Rezvan Parvizi, et al.,
bioRxiv - Genomics 2024
Quote:
... which is a mix of one part collagen (Advanced BioMatrix, 6 mg/mL), one part HEPES (pH 8) ...
-
No products found
because this supplier's products are not listed.
Ming Zhang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... we tested 5hmC level by qPCR with BisulPlus™ Loci 5mC & 5hmC Detection PCR Kit (EpiGentek, #P-1067). Briefly ...
-
No products found
because this supplier's products are not listed.
Christopher Rovera, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... mix and seeded in glass-bottom 96-well plate (#P96G-1.5-5-F, MatTek). Once the gel was set (1h at 37°C) ...
-
No products found
because this supplier's products are not listed.
Faisal Almansour, et al.,
bioRxiv - Cell Biology 2024
Quote:
... we used the same RP11 BAC probes tagged with Green 5-Fluorescein Conjugated dUTP (Empire Genomics).
-
No products found
because this supplier's products are not listed.
Kathrin Leppek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 1.6 g/L amino acids drop out mix (Complete Supplement Mixture, CSM, Sunrise Science Products)) ...
-
No products found
because this supplier's products are not listed.
Joel Cyrille Brenner, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 0.5% glutaraldehyde using the Master Gradient 108 (BioComp Instruments, New Brunswick, Canada, program 5-45% Sucrose, 45 s). The generated gradient was incubated for 60 min at 4 °C ...
-
No products found
because this supplier's products are not listed.
Iris Lindberg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... proSAAS (AAV 2/6; Vigene Biosciences) or enhanced green fluorescent protein (GFP; AAV 2/6; Vector Biolabs) was driven by the human SYN1 promoter ...
-
No products found
because this supplier's products are not listed.
Susanne Herppich, et al.,
bioRxiv - Immunology 2021
Quote:
... the staining mix always contained unconjugated anti-FcRγIII/II antibody (BioXcell; final concentration 10 µg ml-1). For exclusion of dead cells ...
-
No products found
because this supplier's products are not listed.
Morgane Rosendale, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Red and green fluorescence images were obtained 200 ms apart using a filter wheel (Lambda 10-3, Sutter Instruments). To correct for x/y distortions between the two channels ...
-
No products found
because this supplier's products are not listed.
Carlos Manlio Díaz-García, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the viral mix was loaded onto a pulled glass capillary pipette (Wiretrol II, Drummond Scientific Company, Broomall, PA) and the pups were intracranially injected with 150 nl of the AAV mix ...
-
No products found
because this supplier's products are not listed.
Samuel E. Lacey, Helen E. Foster, Gaia Pigino,
bioRxiv - Molecular Biology 2022
Quote:
Quantifoil R3.5/1 Au200 grids were plasma cleaned for 10s with a 80:20 oxygen:hydrogen mix (Solarus II Model 955, Gatan). 4uL cells were added to grid ...
-
No products found
because this supplier's products are not listed.
Soorya Pradeep, Thomas A. Zangle,
bioRxiv - Bioengineering 2021
Quote:
... with an Olympus U-FBNA filter cube for green mAG fluorophore and Semrock mCherry-B-000 filter cube (IDEX health & science, USA) for imaging the red mKO2 fluorophore ...