-
No products found
because this supplier's products are not listed.
Karl Alex Hedin, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 2x SensiFAST SYBR® Lo-ROX mix (Nordic BioSite) was used for all qPCR reactions ...
-
No products found
because this supplier's products are not listed.
Yang-Yang Li, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and stained with SYBR Green II RNA gel stain (Solarbio, #SY1040). A Qubit protein assay kit was used to measure the protein concentration of the sample ...
-
No products found
because this supplier's products are not listed.
Adele Xu, et al.,
bioRxiv - Genetics 2022
Quote:
... The click reaction master mix was prepared per manufacturer instructions (Click Chemistry Tools 1381) and 250 uL was added to each sample ...
-
No products found
because this supplier's products are not listed.
April L. Peterson, Bret A. Payseur,
bioRxiv - Evolutionary Biology 2020
Quote:
... The master mix recipe contained polyclonal anti-rabbit anti-MLH1 (Calbiochem, San Diego CA; diluted 1:50) or anti-rabbit anti-DMC1 (mix of DMC1) ...
-
No products found
because this supplier's products are not listed.
Kristina Naasen Hellesnes, et al.,
bioRxiv - Biochemistry 2023
Quote:
... PAGE-MASTER Protein Standard Plus (GenScript) was used for the identification of target proteins.
-
No products found
because this supplier's products are not listed.
Pavel Shekhtmeyster, et al.,
bioRxiv - Neuroscience 2021
Quote:
... green fluorescence reference slide (2273, Ted Pella), and blue LED excitation light source (M470L3 ...
-
No products found
because this supplier's products are not listed.
Sardar Pasha Sheik Pran Babu, et al.,
bioRxiv - Pathology 2020
Quote:
... These animals were genotyped by qPCR according to a protocol from Jackson Laboratory (https://www2.jax.org/protocolsdb/f?p=116:5:0::NO:5:P5_MASTER_PROTOCOL_ID,P5_JRS_CODE:21675,002662) ...
-
No products found
because this supplier's products are not listed.
Saptarshi Mallick, et al.,
bioRxiv - Physiology 2022
Quote:
... 2X TaqMan Universal Master Mix (Applied Biosystems, TaqMan® Gene Expression Systems), and cDNA template ...
-
No products found
because this supplier's products are not listed.
Francisco J. Calero-Cuenca, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Reverse transcription quantitative PCR (RT-qPCR) was performed using Power SYBR Green PCR MasterMix (Alfagene) according to the manufacturer’s instructions and using primers forward and reverse at 0,25 μM (final concentration ...
-
No products found
because this supplier's products are not listed.
J. Martinez-Fabregas, et al.,
bioRxiv - Immunology 2020
Quote:
... Agencourt AMPure XP beads and PCR amplified using KAPA hot start High-Fidelity 2X PCR Master Mix and NextFlex index primers (Bioo Scientific, PerkinElmer) for 12 cycle by following thermocycler cycles ...
-
No products found
because this supplier's products are not listed.
M. Kyle Cromer, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The following primers were then used to amplify respective cut sites at HBA2 and HBA1 along with CleanAmp PCR 2x Master Mix (TriLink, San Diego, CA, USA) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... PCRs used GoGreen Taq Plus Master Mix (Lamda Biotech) with general cycling conditions of 95 C for 2 min ...
-
No products found
because this supplier's products are not listed.
Seth Winfree, et al.,
bioRxiv - Physiology 2022
Quote:
... antibodies were reduced using a “Reduction Master Mix” (Akoya Biosciences) to which lyophilized barcodes resuspended in molecular biology grade water and “Conjugation Solution” (Akoya Biosciences ...
-
No products found
because this supplier's products are not listed.
Satyaki Ghosh, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 1 μl of 1,000X SYBR Green I (AMRESCO Inc., Solon, OH) was added ...
-
No products found
because this supplier's products are not listed.
William K. Boyle, et al.,
bioRxiv - Microbiology 2020
Quote:
... using Bullseye EvaGreen Master Mix (MIDSCI, St. Louis, MO, United States) reagents and oligonucleotide primers targeting the gene of interest (Supplemental Table 1) ...
-
No products found
because this supplier's products are not listed.
Leemon Nikhila, et al.,
bioRxiv - Cell Biology 2023
Quote:
... SYBR Green-Labelled PCR primers for all targeted genes were purchased from G-Biosciences made in (St ...
-
No products found
because this supplier's products are not listed.
Youssouf Sereme, et al.,
bioRxiv - Microbiology 2020
Quote:
... the poliovirus antigen (0.24 μg/μL) was mixed with fluorescent 5X master mix (Protein Simple) to achieve a final concentration of 0.20 μg/μL in the presence of fluorescent molecular weight markers and 400 mM dithiothreitol (DTT ...
-
No products found
because this supplier's products are not listed.
Kathryn M. Polkoff, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and a growth factor master mix was added for final concentrations of CHIR99021 (PeproTech, 2520691) (5 μM) ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
No products found
because this supplier's products are not listed.
Angela Meccariello, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... The injection master mix also included preassembled RNP complex of Cas9 protein (200 ng/ml) (PNA Bio)33 ...
-
No products found
because this supplier's products are not listed.
Ericka Kirkpatrick Roubidoux, et al.,
bioRxiv - Immunology 2023
Quote:
... Four microliters of RNA were added to a 16ul master mix containing nuclease-free water (Teknova, Cat No. W3330), TaqMan Fast Virus 1-Step Master Mix (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
D. Blaine Marchant, Brad Nelms, Virginia Walbot,
bioRxiv - Plant Biology 2022
Quote:
... 12.5 µL Ultra II Q5 Master Mix, 1 µL of 10 µM RP1, 1 µL of 10 µM RPI “X”). Libraries were amplified with 13 rounds of PCR (98□ for 30 sec ...
-
No products found
because this supplier's products are not listed.
Bailey Layish, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cells were monitored quarterly for retroviral contamination by SYBR-Green based PCR RT assay (43, 44) and tested for mycoplasma contamination by MycoStrip® detection kit (InvivoGen). Derivatives of HeLa and HT1080 cells containing doxycycline-inducible Mx2 ...
-
No products found
because this supplier's products are not listed.
Jordan S Kesner, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The BAG6 target region was amplified from the genomic DNA from all samples using Q5 High-Fidelity Master Mix and subsequently purified using a NucleoSpin Gel and PCR Clean-up kit from Macherey-Nagel. The purified samples were sent for sanger sequencing and the proportion of BAG6 knockout cells in each sample was estimated using the ICE CRISPR analysis tool (https://www.synthego.com/products/bioinformatics/crispr-analysis).
-
No products found
because this supplier's products are not listed.
Nelson V. Simwela, et al.,
bioRxiv - Microbiology 2020
Quote:
... plates were read to quantify SYBR Green I® fluorescence intensity in each well by a PHERAstar® FSX microplate reader (BMG Labtech) with excitation and emission wavelengths of 485 and 520nm respectively ...
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... Human CXCL9 qPCR primer pair (HP100773) and Human CXCL12 qPCR primer pair (HP100192) were obtained from Sino Biological Inc ...
-
No products found
because this supplier's products are not listed.
Tristan Frum, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Slides were treated with 2x HistoClear II (National Diagnostics, Cat#HS-202) washes ...
-
No products found
because this supplier's products are not listed.
Daniel P. Ball, et al.,
bioRxiv - Immunology 2021
Quote:
... and mixed with Western blot sample loading buffer (2X loading buffer (LI-COR), 100 mM DTT ...
-
No products found
because this supplier's products are not listed.
Julie A. Shields, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... with lentiviral packaging mix (Cellecta), lipofectamine 3000 transfection reagent (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
CL Marchant, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Green Fluorescent Fibronectin (Cytoskeleton, Inc HiLyte 488) was used to determine gel functionalisation in Supplementary Fig ...
-
No products found
because this supplier's products are not listed.
Tao Guo, et al.,
bioRxiv - Plant Biology 2019
Quote:
... a Malachite Green Assay Kit (Echelon Biosciences) was used to detect the liberated phosphate among different PI substrates according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Samuel Collombet, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... using dUTP labelled with spectrum green (Abbott) for Huwe1 and Cy5 (Merck ...
-
Phosphate Assay Kit (POMG-25H)
Cat# POMG-25H,
1.0 kit, 2500 tests, USD $219.0
Ask
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
Malachite Green Phosphate Assay Kit (BioAssay Systems);
-
No products found
because this supplier's products are not listed.
Sehwan C Park, et al.,
bioRxiv - Genomics 2019
Quote:
... supplemented with Torpedo antibiotic mix (BioIVT) per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
E Chuntharpursat-Bon, et al.,
bioRxiv - Cell Biology 2019
Quote:
... perfusion set (yellow/green) and fluidics unit (Ibidi). Cells were exposed to shear stress of 10 dyn.cm−2 for 24 hr ...
-
No products found
Sheng Xia, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... and placed in a prewarmed digestion enzyme mix - inflation enzyme mix plus 0.5mg/mL DNase 1 (Worthington Biochemical). They were placed in an incubator at 37C and rotated for 15min ...
-
No products found
because this supplier's products are not listed.
Vijay Kumar, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... Volatile Acids Mix (Cayman Chemicals Co., USA) was used as standard at concentration range 100-6400µM ...
-
No products found
because this supplier's products are not listed.
Viola Nähse, et al.,
bioRxiv - Cell Biology 2022
Quote:
ATPase activity was measured by quantifying the release of inorganic phosphate using a modified Malachite Green Phosphate assay (Biomol Green, Enzo). All measurements were performed according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Manali M. Kamath, et al.,
bioRxiv - Microbiology 2023
Quote:
... Green bead lysis kits (Next Advance, New York, USA) that contain stainless steel beads in combination with TissueLyser LT (Qiagen ...
-
No products found
because this supplier's products are not listed.
Simona Notova, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 45% precipitant mix 6 Morpheus II (Molecular Dimensions) for SeMet protein ...
-
No products found
because this supplier's products are not listed.
Matthew Neubauer, Roger W. Innes,
bioRxiv - Plant Biology 2020
Quote:
... seed was directly sowed onto Pro-Mix PGX Biofungicide plug and germination mix supplemented with Osmocote 14-14-14 fertilizer (ICL Fertilizers). Plates and flats were placed at 4°C for 48 hours for stratification before being transferred to a growth room set to 23°C and 12 hour light (150 µEm-2s-1)/12 hour dark cycle ...
-
No products found
because this supplier's products are not listed.
Chiara Cassioli, et al.,
bioRxiv - Immunology 2020
Quote:
... and analyzed by RT-qPCR on 96-well optical PCR plates (Sarstedt) using the SsoFast™ EvaGreen® Supermix (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Stefan Zdraljevic, et al.,
bioRxiv - Genetics 2019
Quote:
... two master mixes were prepared: a) LT-1 transfection reagent (Mirus) was diluted 1:10 in Opti-MEM and incubated for five minutes ...
-
No products found
because this supplier's products are not listed.
Raquel P. de Sousa Abreu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... chicken α-Green Fluorescence Protein (GFP) (Aves Labs, Inc., GFP-1010), and goat α-Choline Acetyltransferase (ChAT ...
-
No products found
because this supplier's products are not listed.
Raluca Groza, et al.,
bioRxiv - Biophysics 2023
Quote:
... Purified recombinant Enhanced Green Fluorescent Protein (EGFP) was purchased from Chromotek. Bafilomycin A1 was purchased from InvivoGen ...
-
No products found
because this supplier's products are not listed.
Eliza S. Lee, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... the coverslips were washed three times with 2X SSC buffer with 10% formamide and mounted onto coverslips using DAPI Fluoromount-G stain mounting solution (Southern Biotech). Cells were imaged and quantified as previously described (60).
-
No products found
because this supplier's products are not listed.
Mingqi Zhou, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... using the SMRTbell Enzyme Clean-Up Mix (PacBio, 101-932-600). Library construction typically yielded sufficient SMRT bell library (∼ 70 ng ...
-
No products found
because this supplier's products are not listed.
Farhana Islam, Padmaja P. Mishra,
bioRxiv - Biophysics 2023
Quote:
... The experiments were conducted using a Monolith NT.115 Blue/Green instrument (NanoTemper Technologies) in three independent replicates ...
-
No products found
because this supplier's products are not listed.
Kseniya Ustinova, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Obtained peptide mix was desalted with a MicroSpin C18 column (The Nest Group, Inc) prior to LC-MS/MS analysis ...
-
No products found
because this supplier's products are not listed.
Patrick N. Reardon, et al.,
bioRxiv - Biophysics 2023
Quote:
... RNA bands were stained with Midori Green Nucleic Acid staining solution (Bulldog Bio. Inc. Portsmouth, NH) and visualized using a Bio-Rad Gel Doc Image system.