-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Ann Marie Centner, et al.,
bioRxiv - Cell Biology 2024
Quote:
... A commercial Cotinine ELISA kit (Origene) suitable for mice was used to quantify blood levels ...
-
Keratin 20 Cell ELISA Kit is a cell-based ELISA Kit. Cells to be assayed should be seeded onto a...
Cat# abx595342-96T,
96 tests USD $572.75
Ask
Robert Schierwagen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
We determined plasma levels of beta-arrestin-2 using an ELISA kit (Human Beta-arrestin-2 ELISA Kit; # abx251362; Abbexa) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
J. Tabitha Hees, Angelika B. Harbauer,
bioRxiv - Neuroscience 2023
Quote:
... AA (Alfa Aesar; 5 nM or 20 µM) or ethanol was added to the neurons ...
-
No products found
because this supplier's products are not listed.
Yini Zhu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... kit (Tonbo Biosciences, 20-1172), and EpCAM (BioLegend ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... I-FABP (Human I-FABP ELISA Kit, Hycult biotech, Cat# HK406), and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
Sybille Koehler, et al.,
bioRxiv - Cell Biology 2020
Quote:
Urinary albumin levels were measured with a mouse albumin ELISA kit (ICL/Dunn Labortechnik GmbH ...
-
No products found
because this supplier's products are not listed.
Chloe R. Koulouris, et al.,
bioRxiv - Biophysics 2021
Quote:
... 5% ethylene glycol and 20% PEG Smear Broad (Molecular Dimensions). This crystallisation condition differs from that reported in a recent crystal structure of holo SR (6SLH ...
-
No products found
because this supplier's products are not listed.
Saritha S. D’Souza, et al.,
bioRxiv - Cell Biology 2021
Quote:
... A p27 ELISA (Zeptometrix) was performed on each time point according to the manufacturer’s instructions to determine the amount of virus produced in each well.
-
No products found
because this supplier's products are not listed.
Srinjoy Sil, Jef D Boeke, Liam J Holt,
bioRxiv - Cell Biology 2022
Quote:
... 5×5 large images were acquired with 20% overlap using the ND Acquisition feature NIS Elements software (Nikon) and were stitched together using the SiR-DNA channel.
-
No products found
because this supplier's products are not listed.
Chunsheng Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... and plate-bound α-CD3 (clone 145-TC11, 5 ug/ml; BioXCell) in complete RPMI medium supplemented with 10% fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Radek Jankele, Rob Jelier, Pierre Gönczy,
bioRxiv - Cell Biology 2021
Quote:
... or into a bead slurry containing 20 µm polystyrene beads (Polysciences - #18329-5) in M9 + 0.5% (w/v ...
-
No products found
because this supplier's products are not listed.
Kotaro Tomuro, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Cells seeded in 6-well plates were treated with 20 μM OP-puro (Jena Bioscience) at 37°C for 30 min ...
-
No products found
because this supplier's products are not listed.
Man Gao, et al.,
bioRxiv - Plant Biology 2022
Quote:
... and a Luna C18(2) trap column (5 μm; 100 Å; 20×0.5 mm; Phenomenex) with a column temperature of 55 °C ...
-
No products found
because this supplier's products are not listed.
Raphael D. Teixeira, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 20 % PEG 3350 from condition C8 of PEG/Ion HT crystallization kit (Hampton Research). DgcR_act was crystallised by the same protocol ...
-
No products found
because this supplier's products are not listed.
Isabel Schultz-Pernice, et al.,
bioRxiv - Microbiology 2023
Quote:
... Slides were subsequently washed three more times for 5 minutes by immersion in 0.1% Tween-20 in PBS and mounted in EMS Shield Mount with DABCO (Electron Microscopy Sciences). Imaging was performed using a Carl Zeiss LSM710 confocal microscope at the microscopy imaging center (MIC ...
-
Prepared to contain higher collagenase and caseinase activities. A dialyzed, lyophilized powder.
Cat# LS005282,
1 gm, $246.00
Ask
Tobias Kaiser, Guoping Feng,
bioRxiv - Neuroscience 2019
Quote:
... Brains were minced into small pieces and transferred to a dounce-homogenizer containing 5 ml ice-cold HBSS with 20 µg/ml DNase I (Worthington, DPRF, LS006343). Tissue chunks were homogenized with 15 loose and 15 more tight strokes and the homogenate was transferred to a 50 ml falcon tube through a pre-wet 70 µm strainer ...
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Jia-Pu Liang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dex ELISA kit (Cat. No. 101516; Neogen) and E2 High sensitivity ELISA kit (Cat ...
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Charlene J. Miller, et al.,
bioRxiv - Microbiology 2023
Quote:
... an ELISA kit from Life Diagnostics (West Chester, PA). Assays were completed according to the manufacturer’s recommended protocols and all samples were assessed in duplicate ...
-
No products found
because this supplier's products are not listed.
Hailong Guo, et al.,
bioRxiv - Microbiology 2023
Quote:
384 well ELISA plates were coated with 20µl of RBD (SARS-CoV-2 Omicron BA.1, ACROBiosystems) at 1µg/mL in PBS at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Jing Qin Wu, et al.,
bioRxiv - Microbiology 2019
Quote:
... the 20 kb BluePippin kit (PacBio) was used and DNA libraries were sequenced on a PacBio Sequel System with Sequel Sequencing chemistry 2.1 ...
-
No products found
because this supplier's products are not listed.
Abigail E. Powell, et al.,
bioRxiv - Immunology 2020
Quote:
... plates were washed 3X with PBST and blocked overnight at 4 °C with ChonBlock Blocking/Dilution ELISA Buffer (Chondrex). ChonBlock was removed manually and plates were washed 3X with PBST ...
-
No products found
because this supplier's products are not listed.
Chia-Ying Huang, et al.,
bioRxiv - Biophysics 2023
Quote:
... and they were then acoustically dispensed into SwissCI 3-lens crystallization plates (SWISSCI) at a final fragment concentration of 20 mM (20% final concentration of DMSO) using an Echo550 system (Labcyte). The plates were then sealed and incubated at 20°C ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... placed on top of a multi-well plate vacuum manifold (Operated at 20 Hg) with a receiver plate on the bottom (Pall Corporation). A portion (5 µL ...
-
20-Hydroxyecdysone (Ecdysterone, 20E, B-ecdysone, Commisterone, Crustecdysone) is a naturally...
Cat# S2417, SKU# S2417-10mg,
10mg, $99.00
Ask
Satyaki Sengupta, et al.,
bioRxiv - Cancer Biology 2021
Quote:
5 x105 SH-SY5Y cells were seeded into 10 cm plates and treated with either 5 µM EED226 (Selleck Chemicals) or DMSO (vehicle control ...
-
No products found
because this supplier's products are not listed.
Jessica A. Breznik, et al.,
bioRxiv - Immunology 2022
Quote:
... Teklad 22/5 Rodent Diet) or a high fat (HF) diet (60% kcal fat, 20% kcal protein, 20% kcal carbohydrates; D12492, Research Diets, Inc.) and provided water ad libitum ...
-
No products found
because this supplier's products are not listed.
Zina M. Uckeley, et al.,
bioRxiv - Microbiology 2022
Quote:
... 20:1/20:1, and 22:1/22:1 (Özbalci et al., 2013)) and 5 pmol LPC (17:1, Avanti Polar Lipids). The PE P standard mix consisted of 16.5 pmol PE P-Mix 1 (16:0p/15:0 ...
-
No products found
because this supplier's products are not listed.
Vladimir V Senatorov Jr., et al.,
bioRxiv - Neuroscience 2019
Quote:
... Membranes were blocked for 1 hr at room temperature with 5% non-fat dry milk (Apex #20-241) or 5% BSA (Biotium #22013) in TBST (10 mM Tris ...
-
No products found
because this supplier's products are not listed.
Emanuel J. Novais, et al.,
bioRxiv - Cell Biology 2024
Quote:
... using 5×/0.15 N-Achroplan or 20×/0.5 EC Plan-Neofluar objectives (Carl Zeiss) or a polarizing light microscope (Eclipse LV100 POL ...
-
No products found
because this supplier's products are not listed.
Bohm Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... which was crushed for 3 seconds with Dumont #5 forceps (Fine Science Tools, 11254-20) and special care was taken not to damage the vein sinus ...
-
Cat# HY-N6639,
inquire
Ask
Gaoran Ge, et al.,
bioRxiv - Cell Biology 2023
Quote:
... group (mice treated with 20 mg/kg GANT58) or 5-AzaC (DNMTs specific inhibitor; MedChemExpress) group (mice treated with 2 mg/kg 5-AzaC) ...
-
No products found
because this supplier's products are not listed.
Tejas R. Karhadkar, et al.,
bioRxiv - Immunology 2020
Quote:
5-week old 20 g male and female C57BL/6 mice (Jackson Laboratories, Bar Harbor, ME) were given an oropharyngeal aspiration of 1 mg/kg (or less where indicated ...
-
No products found
because this supplier's products are not listed.
Steven R. Hall, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... All experimental animals (18-20 g [4-5 weeks old], male, CD-1 mice, Charles River, UK) were acclimatised for a minimum of one week before experimentation with their health monitored daily ...
-
No products found
because this supplier's products are not listed.
Yide Zhang, et al.,
bioRxiv - Bioengineering 2023
Quote:
Female athymic nude mice (Hsd: Athymic Nude-Foxn1nu, Envigo; 15–20 g and 4–5 weeks old) were used for the animal imaging experiments ...
-
No products found
because this supplier's products are not listed.
Sydney P. Thomas, John M. Denu,
bioRxiv - Biochemistry 2021
Quote:
... Samples were collected by adding 20 µL directly to 5 µL of 4X sample loading buffer (LI-COR) and heating at 95C for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Kristen W. Cohen, et al.,
bioRxiv - Immunology 2021
Quote:
Samples were single-cell sorted into 96-well PCR plates containing 5 µL of DNA Suspension Buffer (Teknova) with 1% BSA (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Qinqin Zhao, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 0.1% w/v Tween-20) with 5% w/v bovine serum albumin (BSA) (RPI CAS #9084-46-8) at room temperature for 1 hr ...
-
No products found
because this supplier's products are not listed.
Nikhila S Tanneti, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Reverse-phase chromatography was performed over a 20 cm IntegraFrit column (IF360–75-50-N-5, New Objective, Woburn, MA) packed in-house with 1.9 μm ReproSil-Pur C18-AQ (Dr ...
-
No products found
because this supplier's products are not listed.
Roman Czornobil, et al.,
bioRxiv - Physiology 2023
Quote:
... Total protein (5∼15 µg) was loaded and separated by 4–20% pre-made SDS-PAGE gels (#4568095, BioRad, Mini-PROTEAN TGX Stain-Free Precast Gels ...
-
No products found
because this supplier's products are not listed.
Guillaume A Castillon, et al.,
bioRxiv - Cell Biology 2023
Quote:
... then incubated for 20 seconds with 20% 10 nm gold fiducials (Ted Pella#15703-20) + 0.05% BSA in water ...
-
No products found
because this supplier's products are not listed.
Julian R. Smith, et al.,
bioRxiv - Immunology 2022
Quote:
H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
No products found
because this supplier's products are not listed.
Laura Mòdol, Monika Moissidis, Oscar Marín,
bioRxiv - Neuroscience 2023
Quote:
... a custom-made head plate containing a 5 mm diameter hole was fixed to the skull using veterinary adhesive (Vetbond, 3M). Once the head plate was fixed and stabilized ...
-
No products found
because this supplier's products are not listed.
Gregor Diensthuber, et al.,
bioRxiv - Genomics 2023
Quote:
... using 5-Methyluridine-5’-Triphosphate (5-mUTP, Trilink, N-1024-1) instead of UTP ...
-
No products found
because this supplier's products are not listed.
Ruth M. Saecker, et al.,
bioRxiv - Biophysics 2024
Quote:
... equipped with a BioQuantum Imaging filter (slit width 20 eV) and either a K3 (tr-Spotiton datasets) or a K2 (5°C dataset) direct electron detector (Gatan, Inc., Pleasanton, CA). All tr-Spotiton grid images were recorded in counting mode with a physical pixel size of 0.844 Å ...
-
No products found
because this supplier's products are not listed.
Alexandre Guiraud, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Real-time PCR was performed in a 20 μL final volume using the Takyon No Rox SYBR kit (Eurogentec). Fluorescence intensity was recorded using a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Tao Qiu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... total RNA from the cells plated on 96 well plates were first extracted and purified using the RNAprep Pure Micro Kit (TIANGEN). Reverse transcription was performed with HiScript III cDNA Synthesis Kit (Vazyme) ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...