-
No products found
because this supplier's products are not listed.
Sarah Hofmann, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5 ug/ml insulin (PromoCell), 0.5 ug/ml Hydrocortisone ...
-
No products found
because this supplier's products are not listed.
Zhongyun Xie, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the lysate was made from 1∼2 ml packed worms with 3∼4 ml of 0.5-mm diameter glass beads using FastPrep-24 (MP Biomedicals) in lysis buffer [pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Karen. M. Marshall, et al.,
bioRxiv - Bioengineering 2023
Quote:
... the scaffolds seeded with C2C12 cells were moved to a 24 well plate and 1.5 mL of media was added (basal with 2% FCS ± 5 µg of BMP-2 (3.33 µg/mL BMP-2). Culture was continued for 4 days and ALP staining performed on the 5th day from cell seeding ...
-
No products found
because this supplier's products are not listed.
Alasdair G Rooney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... EdU (5-Ethynyl-2’-Deoxyuridine, Carbosynth NE08701, 10mg/ml) was administered on each day of ECS ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Maria Magdalena Klicznik, et al.,
bioRxiv - Immunology 2019
Quote:
... 130-045-101) and 4×106 cells/ml were resuspended in RPMIc with 50 U/ml IL-2 (Immunotools; 11340023) in a 24-well and stimulated for 20h with 25μl/ml ImmunoCult CD3/CD28 T cell activator (Stemcell ...
-
No products found
because this supplier's products are not listed.
Jack E. Feltham, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 100 ug/ml cycloheximide) and macromolecular complexes were separated by velocity gradient ultracentrifugation (SW41Ti – Beckman, 39,000 rpm, 2 hr, 4oC). Fractions were collected using Biocomp Gradient Station and pooled to obtain separate monosomal and polysomal fractions ...
-
No products found
because this supplier's products are not listed.
Jesse E Bucksot, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Four New Zealand white male rabbits (Charles River, 3 to 6 months old, 2 to 4 kg) were housed in a 12:12 h light-dark cycle ...
-
No products found
because this supplier's products are not listed.
John C. Obenauer, et al.,
bioRxiv - Neuroscience 2023
Quote:
The proteomics signature had 4 validation data sets: R6/2 mice aged 2 months (R6/2 2M) or 3 months (R6/2 3M) from PRIDE experiment PXD013771 ...
-
No products found
because this supplier's products are not listed.
Dillon S. McDevitt, et al.,
bioRxiv - Neuroscience 2019
Quote:
... recording electrodes (2-5 MΩ; borosilicate glass capillaries (WPI #1B150F-4) pulled on a horizontal puller from Sutter Instruments (model P-97) ...
-
No products found
because this supplier's products are not listed.
Sophie Tronnet, et al.,
bioRxiv - Microbiology 2024
Quote:
... Samples of 2 ml were collected in 2 ml microtubes (Sarstedt, ref 72.690.001) 180 min after the addition of the compounds and centrifuged at 13000 x g for 2 min ...
-
No products found
because this supplier's products are not listed.
Tonia K. Tsinman, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and supplemented with 1mg/mL Proteinase K (Zymo Research, Cat#: D3001-2-5) for 1 hour at 55°C ...
-
No products found
because this supplier's products are not listed.
Mario Mietzsch, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3.5 μL was applied to a glow-discharged Quantifoil copper grid with 2 nm continuous carbon support over holes (Quantifoil R 2/4 400 mesh), blotted ...
-
No products found
because this supplier's products are not listed.
Olivier Da Ines, et al.,
bioRxiv - Genetics 2022
Quote:
... 2 mM X-Gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronic acid; Biosynth), dissolved in N,N-dimethylformamide) ...
-
No products found
because this supplier's products are not listed.
Tim Nierhaus, et al.,
bioRxiv - Microbiology 2021
Quote:
... pooled and concentrated to 2-3 mg/ml using Vivaspin 15R concentrators (2 kDa MWCO HY, Sartorius). Small aliquots were flash-frozen in liquid nitrogen and stored at −80°C ...
-
No products found
because this supplier's products are not listed.
Logan K. Smith, Kareem Fawaz, Bebhinn Treanor,
bioRxiv - Immunology 2020
Quote:
... and 50 μM 2-mercaptoethanol (Amresco) at 37°C with 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Nicole DelRosso, et al.,
bioRxiv - Systems Biology 2022
Quote:
... 2 ul per tube was transformed into two tubes of 50 ml of Endura electrocompetent cells (Lucigen, Cat#60242-2) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yan Shin J. Liao, et al.,
bioRxiv - Physiology 2019
Quote:
... containing 2-4% normal goat serum (Jackson Laboratories). Tissues were incubated with primary antibodies for 2 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Trinovita Andraini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3-(2,4-Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone (BML-CM127-0050, Enzo Life Sciences) was injected at 20mg/kg (in 10% DMSO ...
-
No products found
because this supplier's products are not listed.
Óscar Aguilar-Sopeña, et al.,
bioRxiv - Immunology 2023
Quote:
... and IL-2 (50 U/mL, from Proteintech, Germany) for 4 days ...
-
No products found
because this supplier's products are not listed.
R. Christopher D. Furniss, et al.,
bioRxiv - Microbiology 2021
Quote:
... the covalent DsbB inhibitor 4,5-dichloro-2-(2-chlorobenzyl)pyridazin-3-one (final concentration of 50 μM) (Enamine) was added to the medium ...
-
No products found
because this supplier's products are not listed.
Odile Fabre, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2 mM 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR, Toronto Research Chemicals), or 500 ng/mL mouse recombinant Gremlin 1 (R&D Biosciences ...
-
No products found
because this supplier's products are not listed.
Rebecca T. Perelman, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... the 3’-end azide functionalization in presence of 2’-azido-2’-deoxyadenosine-5’triphosphate (ATP-azide, Trilink Biotechnologies) using yeast poly(A ...
-
No products found
because this supplier's products are not listed.
Faye M. Walker, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 2 ug/ul of lysates were sonicated with a Bioruptor Plus (Diagenode) for 20 cycles (30 seconds ON and 30 seconds OFF) ...
-
No products found
because this supplier's products are not listed.
Christopher D. Greer, et al.,
bioRxiv - Immunology 2021
Quote:
... IL-4 (MABTECH, 3311-4APW-2), and IL-10 (MABTECH ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Megan E. Conway, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... 50 ug/ml Gentamicin (Genesee 25-533), 10 uM Y-27632 (Selleckchem S1049) ...
-
No products found
because this supplier's products are not listed.
Stephanie N. Caty, et al.,
bioRxiv - Microbiology 2024
Quote:
... 100 µL of each strain was transferred from the unlabeled glucose M9 media to 5 mL of M9 media with 50% 13C glucose (99% 13C, Cambridge Isotope Laboratory) and 50% natural abundance glucose and allowed to grow overnight at room temperature ...
-
No products found
because this supplier's products are not listed.
Piyush Daga, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4% (3-Aminopropyl)triethoxysilane(APTES)-treated and 2% glutaraldehyde-activated glass-bottom dishes (Ibidi) were used to cast polyacrylamide (PAA ...
-
No products found
because this supplier's products are not listed.
Polymnia Georgiou, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The EPM apparatus consisted of 2 closed arms and 2 open arms (39 × 5 cm each) and was elevated 50 cm above the floor (Stoelting, Woodale, IL). The experiment was carried out as previously described 5 ...
-
No products found
because this supplier's products are not listed.
Ethan A. Older, et al.,
bioRxiv - Biochemistry 2023
Quote:
... using 50 nM hMD-2 (Novus Biologicals), 1 ng/mL LPS-EB Biotin (Invivogen) ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Lucas Bayonés, et al.,
bioRxiv - Neuroscience 2024
Quote:
... stained with 5 mg/ml 4′,6-diamidino-2-phenylindole and visualized using a Nikon C1 Plus laser-scanning confocal microscope (Nikon, Tokyo, Japan). All images were captured at the equatorial plane of the cells ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Sandra Schifferdecker, et al.,
bioRxiv - Microbiology 2022
Quote:
... 2 µM mCLING ATTO488 (Synaptic Systems; stock 50 µM) was added to TZM-bl cells seeded in 15-well µ-Slides Angiogenesis and incubated at 16°C for 30 min ...
-
No products found
because this supplier's products are not listed.
Jiexue Pan, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 2 mg/ml BSA (Solarbio, A8020), and 0.2% saponin (sigma ...
-
No products found
because this supplier's products are not listed.
Jérôme Montnach, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Low resistance borosilicate glass pipettes (2-3 MΩ; Sutter Instruments) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Jeroen van den Berg, et al.,
bioRxiv - Cell Biology 2019
Quote:
... a Lionheart FX automated microscope in combination with sirDNA77 staining was used to generate growth curves with a time resolution of 4 hours for a total time span of 136 hours (microscope maintained at 37°C, 5% CO2 using a 4× lens and a Sony CCD, 1.25 megapixel camera with 2 times binning; BioTek). Quantification of cell number was performed by Gen5 software (BioTek).
-
No products found
because this supplier's products are not listed.
Hui Zhang, et al.,
bioRxiv - Microbiology 2021
Quote:
One ug/ml His-tagged spike RBD protein of SARS-CoV-2 (SPD-C52H3, Acrobiosystems) were immobilized onto 96-well plates (9018 ...
-
No products found
because this supplier's products are not listed.
Caterina Carraro, et al.,
bioRxiv - Systems Biology 2022
Quote:
... antibiotics (50 units/mL penicillin and 50 μg/mL streptomycin) and 2 mM L-glutamine (Euroclone).
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Ligia B. Schmitd, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mice were anesthetized with isoflurane (5% induction, 2-3% maintenance, SomnoSuite Kent Scientific) 10d after the first SNC and the crush placed immediately proximal to the first one ...
-
No products found
because this supplier's products are not listed.
Dora Pinto, et al.,
bioRxiv - Immunology 2020
Quote:
... His-tagged RBD of SARS-CoV or SARS-CoV-2 was loaded for 5 minutes at 3 μg/ml in KB onto anti-Penta-HIS (HIS1K) biosensors (Molecular Devices, ForteBio). Association of mAbs was performed in KB at 15 μg/ml.
-
No products found
because this supplier's products are not listed.
Morgan E. Mouchka, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... Colonies were screened on LB plates with 50 μg/mL ampicillin and 9.5 mg/mL X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside; APExBIO) and Sanger sequencing of the J was used to confirm cloning and successful transformation of the ancestral λ sequence.
-
No products found
because this supplier's products are not listed.
Sarah Chevalier, et al.,
bioRxiv - Neuroscience 2024
Quote:
... was placed in the OFC (AP: +3; ML: +2; DV: -5, in mm from bregma and dura) and a glass microelectrode (PG150-T, Harvard Apparatus, Holliston, MA, USA) filled with 0.4 M NaCl solution was lowered in the DMS (AP ...
-
No products found
because this supplier's products are not listed.
Soeren Lukassen, et al.,
bioRxiv - Genomics 2020
Quote:
... Up to 4 pieces were distributed in 2 ml cyro vials (Greiner Bio-One GmbH). Thereafter ...
-
No products found
because this supplier's products are not listed.
Yeon Soo Kim, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
No products found
because this supplier's products are not listed.
Jenisha Ghimire, et al.,
bioRxiv - Biochemistry 2023
Quote:
... the coverslip-adhered pellicles were placed in 50 mL conical tubes containing a 2 mL suspension of zirconia beads (0.1 mm diameter, BioSpec Products), 10 mL PBS ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Cortical layers 2/3 and 4 neurons were visualized by using an upright microscope and camera system (BX51WIF, Olympus, and SciCam Pro CCD camera ...
-
No products found
because this supplier's products are not listed.
Ines Heyndrickx, et al.,
bioRxiv - Immunology 2023
Quote:
... treatments were given after mice were anesthetized with isoflurane (2 liters/min, 2 to 3%; Abbott Laboratories).