-
Single well glass bottom plate with high performance #1.5 cover glass (0.170±0.005mm). Black...
Cat# P01-1.5H,
20/case, $249.00
Ask
Xiangyu Gong, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Strips were moved to glass bottom plates (Cellvis) before imaging ...
-
No products found
because this supplier's products are not listed.
Michael T.S. Girling, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
The MethylFlash Global DNA Methylation (5-mC) ELISA Easy Kit (Epigentek, USA), utilising a colourimetric assay ...
-
No products found
because this supplier's products are not listed.
Jack Polmear, et al.,
bioRxiv - Immunology 2023
Quote:
96-well high-binding ELISA plates (Sarstedt) were coated overnight at 4°C with either goat anti-mouse IgA ...
-
No products found
because this supplier's products are not listed.
Xiaoning Gao, et al.,
bioRxiv - Cell Biology 2024
Quote:
... ELISA kits from Solarbio, catalogue numbers SEKR-0002 ...
-
No products found
because this supplier's products are not listed.
Bimal Jana, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Inhibitory ExbD-based cyclic peptides were purchased from GenScript USA ...
-
No products found
because this supplier's products are not listed.
Jiansheng Huang, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... MDA-HDL ELISA kit was purchased from Cell Biolabs Inc ...
-
No products found
because this supplier's products are not listed.
Qingwen Qian, et al.,
bioRxiv - Physiology 2022
Quote:
... were measured using commercially available ELISA kits (TSH ELISA kit, G-Biosciences, Cat No. IT6045; free T3 ELISA kit, G-Biosciences, Cat No. IT5691; T4 ELISA kit, G-Biosciences, Cat No ...
-
No products found
because this supplier's products are not listed.
B Tornifoglio, et al.,
bioRxiv - Bioengineering 2022
Quote:
... strips were stepwise dehydrated (Leica TP1020 ...
-
No products found
because this supplier's products are not listed.
Clément Blot, et al.,
bioRxiv - Microbiology 2023
Quote:
... Nrf2 TransAM ELISA-kit (Active Motif) was used to evaluate Nrf2 DNA-binding activity ...
-
No products found
because this supplier's products are not listed.
Chahrazade Kantari-Mimoun, et al.,
bioRxiv - Immunology 2020
Quote:
... a cyclic immunofluorescence device developed by Miltenyi Biotec (publication in preparation). The three displayed images of EpCAM-APC ...
-
No products found
because this supplier's products are not listed.
Atsushi Sugimoto, et al.,
bioRxiv - Microbiology 2022
Quote:
ELISA Kit (41135-1, PBL Assay Science, USA) and the Human IL-29/IL-28B (IFNλ1/3 ...
-
No products found
because this supplier's products are not listed.
Koki Yoshimoto, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human HGF Quantikine ELISA (R&D, DHG00B) and Human MMP-9 Sandwich ELISA Kit (Proteintech, KE00164) were used for cell culture supernatants according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jonathan Enders, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Blood ketones were measured using a hand-held blood monitor and β-hydroxybutyrate blood ketone strips (β-Ketone blood test strips, Abbott Laboratories ...
-
No products found
because this supplier's products are not listed.
Marie R. Jacobovitz, et al.,
bioRxiv - Microbiology 2019
Quote:
... chambers were prepared by placing two 2.5 mm x 5 mm strips of non-toxic double-sided tape (TES5338, Tesa) at the periphery of 35 mm µ-Dishes (# 81166, Ibidi). 1.5% low gelling agarose (LGA ...
-
No products found
because this supplier's products are not listed.
Kelsey Voss, et al.,
bioRxiv - Immunology 2021
Quote:
Autoantibodies were measured with ELISA kits purchased from Alpha Diagnostics: Anti-Histone Total Ig ...
-
No products found
because this supplier's products are not listed.
Geneviève Jolivet, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Anti Müllerian hormone levels were determined in 50 μl aliquots of serum samples by using an ELISA kit (AMH GenII ELISA, with AMH Gen II calibrators and controls, Beckman Coulter, Villepinte, France) as previously described (Bourdon et al ...
-
No products found
because this supplier's products are not listed.
Ziyi Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Add 100 μL Working Biotin Conjugate Antibody (Rat IL-6 ELISA Kit, RK00020; Rat IL-1β ELISA Kit, RK00009; Rat IL-10 ELISA Kit, RK00050, Abclonal, China) in each well ...
-
No products found
because this supplier's products are not listed.
Ross Peterson, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
A Sandwich ELISA (Bovine Lactoferrin ELISA kit, NBP3-12185, Novus Biologicals) was used and adopted to determine bovine lactoferrin concentrations in rat serum ...
-
No products found
because this supplier's products are not listed.
Emanuele Roscioli, et al.,
bioRxiv - Microbiology 2024
Quote:
... ELISA plates were coated with 2 µg/ml of goat anti-human IgG (Southern Biotech) at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... RANKL and insulin were measured by mouse Osteocalcin ELISA Kit (BioVision), OPG ELISA Kit (Boster Biological Technology) ...
-
No products found
because this supplier's products are not listed.
David Camerini, et al.,
bioRxiv - Immunology 2023
Quote:
... ELISA plates were coated overnight with rabbit anti human Fc gamma chain-specific antibody (Jackson ImmunoResearch). Plates were then washed with DPBS ...
-
No products found
because this supplier's products are not listed.
Samantha C. Lauby, Patrick O. McGowan,
bioRxiv - Neuroscience 2020
Quote:
... was measured in the pup serum (n = 5-7 per group) using an ELISA (MP Biomedicals Inc., USA) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yan Fang, et al.,
bioRxiv - Genetics 2023
Quote:
800 C3H/10T1/2 cells were seeded in a 96 well plate (glass bottom culture plates, MatTek, PBK96G-1.5-5-F) and keep cells in 37-degree for 24 h ...
-
No products found
because this supplier's products are not listed.
Kaitlin E. Sullivan, et al.,
bioRxiv - Neuroscience 2022
Quote:
... placed into 8-well strips containing 3 μL of cell collection buffer (0.1% Triton X-100, 0.2 U/μL RNAse inhibitor (Lucigen)) ...
-
No products found
because this supplier's products are not listed.
Pedro de los Reyes, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and 5-µL of SensiFAST SYBR & Fluorescein Kit (Bioline). Each sample was measured in triplicate ...
-
No products found
because this supplier's products are not listed.
Yunfeng Zhang, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
No products found
because this supplier's products are not listed.
Xingyue An, et al.,
bioRxiv - Immunology 2020
Quote:
... 2′-3’′cyclic guanosine monophosphate adenosine monophosphate (cGAMP) from Chemietek (Indianapolis, IN). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) ...
-
No products found
because this supplier's products are not listed.
Jaeok Lee, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 5′-cyclic monophosphate and DAF-FM were purchased from Calbiochem (Darmstadt, Germany) and Molecular Probes® (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Gururaj Shivange, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For coating 96-well ELISA plates (Olympus), the protein solutions (2μg/ml ...
-
No products found
because this supplier's products are not listed.
Rebecca S. Hofford, et al.,
bioRxiv - Neuroscience 2020
Quote:
A morphine ELISA kit (Abnova #KA0935) was used to quantify morphine in serum and DStr ...
-
No products found
because this supplier's products are not listed.
Zhiqing Huang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Enzyme-linked immunosorbent assays (ELISA) using the human POSTN ELISA kit from Aviva Systems (Cat # OKCD09048 ...
-
No products found
because this supplier's products are not listed.
Timur O Yarovinsky, et al.,
bioRxiv - Immunology 2019
Quote:
... We used HBsAg ELISA kit from XpressBio and the HBsAg standard from CellBioLabs to measure serum HBsAg in the chronic HBV infection model.
-
No products found
because this supplier's products are not listed.
Yuji Matsumoto, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
The phosphorylated neurofilament H ELISA kit (BioVendor Laboratorni Medicina AS ...
-
No products found
because this supplier's products are not listed.
Hassan Nassour, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The IP-One ELISA assay kit from CisBio Bioassays ...
-
No products found
because this supplier's products are not listed.
Tom Biton, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The block edges were covered with additional strips of carbon tape and 2-4 strips of copper tape (EMS; cat#77802) and coated with a layer of colloidal silver liquid (EMS ...
-
No products found
because this supplier's products are not listed.
Lisandra Vila Ellis, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... the strips were mounted on slides using Aquamount (18606, Polysciences) with the flat side facing the coverslip ...
-
No products found
because this supplier's products are not listed.
Alice Wedler, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Plates were analyzed 5 days post seeding using an Incucyte S3 (Sartorius). Additionally ...
-
No products found
because this supplier's products are not listed.
John Lees, et al.,
bioRxiv - Molecular Biology 2023
Quote:
MeDIP-Seq libraries for Ion Torrent semiconductor sequencing were performed on the Ion Torrent PGM using a modified protocol from Ion Plus Fragment Library kit (Catalog # 4471252) combined with a 5-hydroxymethylcytosine (5hmC Kit, Catalog # AF-110–0016) immunoprecipitation kit (Diagenode) according to a previously optimized protocol (Guerrero-Bosagna & Jensen ...
-
No products found
because this supplier's products are not listed.
Tao Qiu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... total RNA from the cells plated on 96 well plates were first extracted and purified using the RNAprep Pure Micro Kit (TIANGEN). Reverse transcription was performed with HiScript III cDNA Synthesis Kit (Vazyme) ...
-
No products found
because this supplier's products are not listed.
Johnathan Abou-Fadel, et al.,
bioRxiv - Systems Biology 2019
Quote:
... 5 µm (Phenomenex) column ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ann Marie Centner, et al.,
bioRxiv - Cell Biology 2024
Quote:
... A commercial Cotinine ELISA kit (Origene) suitable for mice was used to quantify blood levels ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... were assayed using ELISA using the Monkey IL12 ELISA Kit (LifeSpan BioSciences, Inc.), Monkey IFN alpha (pan ...
-
No products found
because this supplier's products are not listed.
Brandon J. DeOre, et al.,
bioRxiv - Cell Biology 2020
Quote:
Commercial ELISA kits were purchased from Cytoskeleton (G-LISA) to quantify RhoA and Rac1 activation (Cytoskeleton) ...
-
No products found
because this supplier's products are not listed.
Darach Miller, Adam Dziulko, Sasha Levy,
bioRxiv - Systems Biology 2024
Quote:
Amino-acid additive stocks and selective plates with 5-FOA (GoldBio), hygromycin ...
-
Prepared to contain higher collagenase and caseinase activities. A dialyzed, lyophilized powder.
Cat# LS005282,
1 gm, $246.00
Ask
Gerald Sakamaki, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The dorsal horn strips were digested in a papain solution (45 μL papain, no. 3126; Worthington Biochemical ...
-
No products found
because this supplier's products are not listed.
Bo Xu, et al.,
bioRxiv - Plant Biology 2019
Quote:
... apart from the barley epidermal strips imaged using an Nikon Diaphot 200 Inverted Phase Contrast Microscope (Nikon). Stomatal aperture and density were analyzed using particle analysis (http://rsbweb.nih.gov/ij/).
-
No products found
because this supplier's products are not listed.
Byron Lee, Nima Jaberi-Lashkari, Eliezer Calo,
bioRxiv - Cell Biology 2022
Quote:
HeLa cells were cultured in 5% CO2 on cell culture-treated 10 cm plates (Genesee Scientific, 25-202) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Julian R. Smith, et al.,
bioRxiv - Immunology 2022
Quote:
H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
No products found
because this supplier's products are not listed.
Flavia Chiuppesi, et al.,
bioRxiv - Immunology 2020
Quote:
... 5 ug of fragmented DNAs were converted to SMRTbell libraries using the SMRTbell Template Prep Kit 1.0 (PacBio). The libraries were size-selected (7-kb size cutoff ...