-
No products found
because this supplier's products are not listed.
Loretah Chibaya, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A commercially available cdGMP detection kit (Lucerna Technologies) was used to quantify cdGMP encapsulation ...
-
No products found
because this supplier's products are not listed.
Wenjie Wang, et al.,
bioRxiv - Cancer Biology 2019
Quote:
The P12Y oligonucleotide linked to tyrosine at the 3’-end (5’-HO-GAAAAAAGAGTT-PO4-Tyr-3’, TopoGEN) was labeled at the 5’-end with 32P ...
-
No products found
because this supplier's products are not listed.
Armin Bayati, et al.,
bioRxiv - Cell Biology 2022
Quote:
... was then conjugated with 5 nm gold beads (Cytodiagnostics, cat# CGN5K-5-2), immediately before experimental use ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Jeong-Kyu Han, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The membranes were visualized using an ECL detection kit (SurModics, MN, USA).
-
No products found
because this supplier's products are not listed.
Linghao Hu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... bis-2-(5-phenylacetamido-1,3,4-thiadiazol-2-yl) ethyl sulfide (BPTES, 10 μm, ASTATECH, A11656) was added to the cells in CM3 1 hour before imaging (35) ...
-
No products found
because this supplier's products are not listed.
Jolene Draper, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... plasmid-based reprogramming method by Cellular Dynamics. C305 cells were cultured on matrigel in mTeSR ...
-
No products found
because this supplier's products are not listed.
Caroline M Weight, et al.,
bioRxiv - Immunology 2019
Quote:
... cells were permeabilised with 0.2% Triton X-100 for 10 minutes and blocked for 1 hour in blocking buffer (3% goat serum and 3% BSA in PBS) before incubation with either pneumococcal antisera Pool Q (for 6B or 23F detection, SSI Diagnostica), or pneumococcal antisera Type 4 (for TIGR4 and dPly detection ...
-
No products found
because this supplier's products are not listed.
Suchitra Joshi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The estradiol levels (n=4) were also measured using an ELISA assay (#ES180S-100 Calbiotech, detection range 3 to 300 pg/mL). The intra-assay variation was 5.9% in these assays.
-
No products found
because this supplier's products are not listed.
Andrew S. Bray, et al.,
bioRxiv - Microbiology 2021
Quote:
... and the suspension serially diluted and plated onto LB agar plates (Fisher, BP9745-2) In between sampling the plates were sealed with parafilm (Bemis, PM-999) and placed in the dark at room temperature.
-
No products found
because this supplier's products are not listed.
Pavel A. Nikitin, et al.,
bioRxiv - Immunology 2022
Quote:
... Plates were washed 3 times with endotoxin-free GVB buffer with Ca2+ and Mg2+ (GVB++, Complement Technology) and incubated with normal human serum (Complement Technology ...
-
No products found
because this supplier's products are not listed.
Xiaoxin X. Wang, et al.,
bioRxiv - Pathology 2020
Quote:
... Another cohort of male C57BL/6 mice with the same age were received the same vehicle as above or the STING inhibitor C-176 (Focus Biomolecules, Plymouth Meeting, PA) at a dose of 1mg/kg body weight/day for 3 weeks via intraperitoneal injection.
-
No products found
because this supplier's products are not listed.
Sandrine Valade, et al.,
bioRxiv - Immunology 2021
Quote:
... ADAMTS13 activity (N: 50-150 IU/dL) was measured with in-house FRETS-VWF73 assay using the recombinant VWF73 peptide (Peptide Institute, Osaka, Japan), as previously described [29] ...
-
No products found
because this supplier's products are not listed.
Heather J. Faust, et al.,
bioRxiv - Cell Biology 2023
Quote:
... ELISA detection of aldosterone was performed using the Aldosterone ELISA Assay Kit from Eagle biosciences (ALD31-K01) according to manufacturer instructions.
-
No products found
because this supplier's products are not listed.
Yuyan Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cholera toxin B subunit (CTB, 3 µl/eye, 2 µg/µl, List Biological Laboratories, Inc., 103B) was injected intraocularly as an anterograde tracer to label axons regenerating through the optic nerve.
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
No products found
because this supplier's products are not listed.
Robert G. Mealer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The reactions were quenched with 2 μL 5% hydroxylamine solution (Oakwood Chemical, Cat # 069272), and the combined mixture was lyophilized ...
-
No products found
because this supplier's products are not listed.
Benjamin P. Brown, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... L747_A750>P (#E10-12MG, lot G1200-3), and L747_E749 (#E10-12LG, lot G1344-5) were purchased from SignalChem. The Promega ADP-Glo™ kinase assay kit was used to quantify the amount of ADP produced by each EGFR variant in 1XBFA buffer and in the presence or absence of erlotinib at varying concentrations ...
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...
-
No products found
because this supplier's products are not listed.
Michael C. Robitaille, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The RGD-based peptide cRGDfK (cRGD, Peptides International, #PCI-3661-PI) was reconstituted in modified Dulbecco’s phosphate buffered saline (DPBS ...
-
No products found
because this supplier's products are not listed.
Jian He, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 100 mg leaf tissues were ground and then total RNA was extracted using a conventional TRIzol-based RNA extraction kit (TRIzon, CoWin Biosciences, Jiangsu, PR China) following the manufacturer’s protocol (see Suplementary Materials) ...
-
No products found
because this supplier's products are not listed.
Ahmed Ali, et al.,
bioRxiv - Biophysics 2023
Quote:
... and sequentially in 1:3 dilution steps added to the wells of PEG-BSA coated ELISA plates (PBSA20PL, Life Diagnostics, Inc.) The plates were incubated for 2 h at RT to allow antibody binding ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Vedagopuram Sreekanth, et al.,
bioRxiv - Bioengineering 2023
Quote:
... were resuspended in 500 μL of hypertonic lysis buffer per plate (40 mM Tris base, 500 mM NaCl, 2 mM MgCl2, and 100 U/ml salt active nuclease (ArcticZymes), and were incubated at 37°C for 1 h to lyse the cells ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Kristina D. Micheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The pellet was then washed twice for 5 min each in a solution of 3 parts LR White acrylic resin (hard grade, SPI supplies Cat# 2645) and 1 part 70% ethanol ...
-
No products found
because this supplier's products are not listed.
Lin Lin, et al.,
bioRxiv - Microbiology 2022
Quote:
... mice infected with HN05 received a treatment of SU1498 (30 mg/kg; inhibitor of VEGFR-2; Catalog NO. 168835-82-3, AdooQ BioScience, US), DMOG (400mg/kg ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Meghan D. J. Bragdon, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
Yeast colonies were picked from plates and cultured overnight in 2 mL liquid synthetic defined (SD) media with appropriate auxotrophic dropouts (Sunrise Science Products). Cultures were diluted 1:50 into 500 µL of synthetic complete (SC ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Michael G. LaMontagne, et al.,
bioRxiv - Microbiology 2022
Quote:
... Temperature and dissolved oxygen were measured in situ at 3 – 5 cm beneath the surface with a YSI model 55 dissolved oxygen (DO) probe (YSI Inc., Young Spring, OH). Water samples were split in the field for FIB (E ...
-
No products found
because this supplier's products are not listed.
Zhongxiao Fu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Slices were perfused continuously with aCSF bubbling with 5% CO2/95% O2 at flow rate about 2 ml/min using two channels peristaltic pump (Dynamax, Rainin, USA).
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Philipp Starkl, et al.,
bioRxiv - Immunology 2023
Quote:
... Primary antibodies and detection reagents used: polyclonal chicken anti-GFP (Aves labs); anti-beta-tubulin III (clone 2G7D4 ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Gab-Chol Choi, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and bone morphogenetic protein 2 (BMP-2) (1:200, orb251474, Biorbyt) primary antibodies at 4°C ...
-
No products found
because this supplier's products are not listed.
Kevin J Pridham, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3% fetal bovine serum (Peak Serum, Inc.), 10 X G-5 Supplement (Gibco) ...
-
No products found
because this supplier's products are not listed.
Rachel Grazda, et al.,
bioRxiv - Immunology 2023
Quote:
200μL fluorescent Dil (DilC18(3))-labeled liposomes (Liposoma) were administered to mice via retro-orbital I.V ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Seul Hoo Lee, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The PET hydrolase reaction was induced on a cellulose dialysis membrane (Spectra/Por 2 Trial Kit, 12–14 kD: flat width 25 mm; Repligen, USA), and bottle-derived PET powder was used as the substrate ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
Gyula Batta, et al.,
bioRxiv - Cell Biology 2020
Quote:
... After spectral compensation and gating out dead cells based on DAPI positivity the time-correlated fluorescence intensities were exported using FCS Express (De Novo Software, Pasadena, CA). A custom-written Matlab program was used for calculating a moving average with a window size of 20 seconds ...
-
No products found
because this supplier's products are not listed.
Javier Emperador-Melero, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5% Fetal Select bovine serum (Atlas Biologicals), 2% B-27 supplement ...
-
No products found
because this supplier's products are not listed.
Cassandre Bedu-Ferrari, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5% H2 atmosphere (Coy Lab Products, USA) (Text S1) ...
-
No products found
because this supplier's products are not listed.
Rebecca O’Cleirigh, Roslyn Gibbs,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... containing 5% (v/v) FCS and incubated overnight in a humidified atmosphere at 37°C and 5% CO2 (Nuaire, DH Autoflow). After 24 hours 1.5mL of the media was removed and media with herb extract or media only control was added ...
-
No products found
because this supplier's products are not listed.
Diego A. Vargas-Blanco, et al.,
bioRxiv - Microbiology 2019
Quote:
... transferred to 2 mL disruption tubes (OPS Diagnostics 100 μm zirconium lysing matrix ...
-
No products found
because this supplier's products are not listed.
Nour Muinis Ramadan, et al.,
bioRxiv - Immunology 2020
Quote:
... supplemented with 5% of sheep blood (LAMPIRE biological laboratories, PA) and incubated anaerobically with CO2 anaerobic pack (AnaeroPack® System ...
-
No products found
because this supplier's products are not listed.
Wei-Chun Chang, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... a cortisol ELISA kit (Salivary Cortisol Enzyme Immunoassay Kit, Salimetrics) was used according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Jie Su, Naoko Toyofuku, Takuro Nakagawa,
bioRxiv - Genomics 2021
Quote:
... After adding 5 to 10 µl Zymolyase 20T (Seikagaku, Tokyo, Japan, 25 mg/ml) and 5 to 10 µl lyzing enzyme (Sigma ...