-
No products found
because this supplier's products are not listed.
Mobashar Hussain Urf Turabe Fazil, et al.,
bioRxiv - Immunology 2021
Quote:
Real-time trans-well migration of T-cells was monitored at 37°C using the CIM-Plate 16 and xCELLigence impedance-based detection system (ACEA biosciences, Singapore) to evaluate transmigration of T-cells towards the chemoattractant SDF-1α (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Hamza A. A. Elati, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2’,3’-dideoxyuridine was from Carbosynth; Pyrimethamine was from Fluka ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Hannah Fitzgerald, et al.,
bioRxiv - Physiology 2023
Quote:
... and anti-Galectin 3 (Mac-2) (Cedarlane Cat# CL8942AP). For this co-stain ...
-
No products found
because this supplier's products are not listed.
Jennifer Schwarz, et al.,
bioRxiv - Biochemistry 2021
Quote:
... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
No products found
because this supplier's products are not listed.
Daisy Precilla S, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Caspase-3 (Cat. No: E-EL-R0160) and BCL-2 (Cat. No: E-EL-H0114) ELISA kits were purchased from Elabscience Biotechnology Inc ...
-
No products found
because this supplier's products are not listed.
Jing Jia, et al.,
bioRxiv - Neuroscience 2020
Quote:
FEF neurons were extracellularly recorded by using single-unit tungsten microelectrodes (FHC; tip diameter 3 μm, impedance 1–2 MΩ). A hydraulic microdrive (FHC ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
Human pulmonary artery endothelial cells HPAEC (3 × 105/well) derived from 3 separate individuals were cultured in 6 well plates with ECM media (ScienCell, Carlsbad, CA) then treated with TGF-β (10 ng/ml) ...
-
No products found
because this supplier's products are not listed.
Laura M. Canaday, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IL-8) (Meso Scale Discovery) and the DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA (PBL Assay Science) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... hiPSCs were seeded onto freshly coated 6-well plates 3 days prior to transduction with premade LV-CAG-eGFP lentivirus (Kerafast FCT149, 1 × 108 CFU/ml). Polybrene (2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Jean-Paul Armache, et al.,
bioRxiv - Biophysics 2019
Quote:
... DNA labeled at two locations for ensemble FRET experiments was prepared by large scale PCR of two DNA templates using labeled primers (IBA Life Sciences). 120μg of each DNA template was digested with AflIII at 37°C overnight and purified by native PAGE ...
-
No products found
because this supplier's products are not listed.
Andrea Mohr, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... multimeric FasL and anti-APO-1-3 from AdipoGen Life Sciences (San Diego ...
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
No products found
because this supplier's products are not listed.
Su Yeon Kim, et al.,
bioRxiv - Neuroscience 2022
Quote:
Brains were washed 3 times for 15 minutes in 1× PBS and embedded in 3% low melt agarose (RPI, A20070) in 1× PBS ...
-
No products found
because this supplier's products are not listed.
Shirin Fatma, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and 2’,2’-cGAMP were purchased from Axxora. All synthetic cyclic dinucleotides were further HPLC purified ...
-
No products found
because this supplier's products are not listed.
Surabhi Mehra, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the Polink-2 Plus HRP Rabbit DAB Detection kit (GBI Labs) was used ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Haruka Kemmoku, et al.,
bioRxiv - Cell Biology 2021
Quote:
... This plasmid was then transfected into immortalized STING-knockout MEFs (Mukai et al., 2016) with PEI MAX (24765-1, Polyscience). Twenty-four hours after transfection ...
-
No products found
because this supplier's products are not listed.
Kristoffer Krogerus, Nils Rettberg, Brian Gibson,
bioRxiv - Microbiology 2022
Quote:
... after which spores from the different parental strains were dissected and placed next to each other on YPD agar plates (1 % yeast extract, 2 % peptone, 2 % glucose, and 2 % agar) using a micromanipulator (Singer Instruments, UK). The plates were incubated at 25 °C for 3 days ...
-
No products found
because this supplier's products are not listed.
Meng Shi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The qPCR was performed using SYBR green based PrecisionFAST kit (Primerdesign) in Bio-Rad CFX96 Touch™ real-time PCR detection system ...
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Robert Egger, et al.,
bioRxiv - Neuroscience 2019
Quote:
... or a 1:1 mix of AAV9.CamKII0.4.Cre.SV40 and either AAV9.CAG.Flex.GCaMP6f.WPRE.SV40 or AAV9.CAG.Flex.GCaMP6s.WPRE.SV40 was injected using an oil-based pressure injection system (Nanoject 3, Drummond Scientific). After injections ...
-
No products found
because this supplier's products are not listed.
Yohan S.S. Auguste, et al.,
bioRxiv - Neuroscience 2022
Quote:
... subcutaneous] before being anesthetized using isoflurane (SomnoSuite, Kent Scientific; 3-5% induction, 1-2% maintenance). Once anesthetic depth was achieved ...
-
No products found
because this supplier's products are not listed.
Esteban J. Rozen, Kim Wgglesworth, Jason Shohet,
bioRxiv - Cancer Biology 2023
Quote:
... All cell lines were tested for Mycoplasma every 2 months using e-Myco™ Mycoplasma PCR Detection Kit (Bulldog Bio #25235), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yusuke Nishimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
Akt1/2/3 inhibitor MK-2206 dihydrochloride (ApexBio, A3010), Rapamycin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Hailong Guo, et al.,
bioRxiv - Microbiology 2023
Quote:
384 well ELISA plates were coated with 20µl of RBD (SARS-CoV-2 Omicron BA.1, ACROBiosystems) at 1µg/mL in PBS at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Austin Clyde, et al.,
bioRxiv - Biophysics 2021
Quote:
... The FRET substrate DABCYL-KTSAVLQ↓SGFRKM-E(EDANS) trifluoroacetate salt was purchased from Bachem (PN 4045664), dissolved to 10 mM in DMSO and stored in aliquots at −20 °C ...
-
No products found
because this supplier's products are not listed.
Uxoa Fernandez-Pelayo, et al.,
bioRxiv - Cell Biology 2024
Quote:
... using the Venor Gem Classic Mycoplasma PCR Detection Kit (Minerva Biolabs).
-
No products found
because this supplier's products are not listed.
Alessandro Piccin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Each chamber was equipped with 2 pellet dispensers that delivered grain (Rodent Grain-Based Diet, 45mg, Bio-Serv) or sugar (LabTab Sucrose Tablet ...
-
No products found
because this supplier's products are not listed.
Mira N. Moufarrej, Stephen R. Quake,
bioRxiv - Bioengineering 2022
Quote:
2 mL deep well plates (Thomas Scientific, cat. no. 1149J85)
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... cleaved-caspase 3 (1:1000, Bioworld), Pro-Caspase 3 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Aneela Nomura, et al.,
bioRxiv - Immunology 2023
Quote:
... in a rounded 96-well plate for 5 hours in the presence of 2 μM of Monesin (Biomol, Cay16488-1). TH17 cells were stimulated as per manufacturer’s instructions (R and D systems ...
-
No products found
because this supplier's products are not listed.
J Muir, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-(2-carboxypiperazin-4-yl) propyl-1phosphonic acid (CPP, 10 mM; HelloBio). Inhibitory postsynaptic currents (IPSCs ...
-
No products found
because this supplier's products are not listed.
Alexey Kolodkin, et al.,
bioRxiv - Systems Biology 2019
Quote:
... PC12 (2×105 cells/well) were plated in 6-well plates (EuroClone) pre-coated with poly-L-lysine (0.1 mg/ml) ...
-
Microtiter Plates (P96UV)
Cat# P96UV,
1.0 plate, , USD $19.0
Ask
Jakub Muraszko, et al.,
bioRxiv - Genetics 2020
Quote:
ATPase activity was measured using a commercial malachite green phosphate detection kit (BioAssay Systems) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Károly Jambrovics, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Phosphatidyl-inositol levels were determined with an ELISA detection kit (K-2500S, Echelon Biosciences) and normalized to 100 μg protein.
-
No products found
because this supplier's products are not listed.
Daniel A Ciulla, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Visualization of HRP was accomplished by colorimetric detection (Femto-Chromo HRP kit, G-Biosciences).
-
No products found
because this supplier's products are not listed.
William Beimers, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 1-2 mg/mL Zymolyase (AMSBIO, 120493-1)] for lysis at 30°C for 15 min ...
-
No products found
because this supplier's products are not listed.
Samuel Schmidt, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and detached from the culture plate by EDTA (2 mM, PAN Biotech, P10-026500) in 1X PBS (Gibco ...
-
No products found
because this supplier's products are not listed.
Ryan Cardiff, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
Single colonies from LB-agar plates were inoculated in 2 mL EZ-RDM (Teknova) with 10 g/L glucose ...
-
No products found
because this supplier's products are not listed.
Matthew P. Ostrowski, et al.,
bioRxiv - Microbiology 2021
Quote:
... Plates were sealed with Breathe-Easy gas permeable sealing membrane for microtiter plates (Diversified Biotech, cat #BEM-1). Microbial growth was measured at least 60 hours by monitoring OD600 using a Synergy HT plate reader (Biotek Instruments ...
-
No products found
because this supplier's products are not listed.
Thomas A. Packard, et al.,
bioRxiv - Cell Biology 2021
Quote:
HLAC cells were stimulated for 3 days with plates coated with 10 µg/mL anti-CD3 (UCHT1, Tonbo Biosciences) and 10 µg/mL anti-CD28 (CD28.2 ...
-
No products found
because this supplier's products are not listed.
Ming Zhang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... we tested 5hmC level by qPCR with BisulPlus™ Loci 5mC & 5hmC Detection PCR Kit (EpiGentek, #P-1067). Briefly ...
-
CytoSoft® products provide a tool to culture cells on PDMS substrates with various rigidity...
Cat# 5141-5EA,
6 well, USD $160.0
Ask
Rachel Mardjuki, et al.,
bioRxiv - Biochemistry 2024
Quote:
293T cGAS ENPP1-/- cells were plated in tissue culture treated plates coated with 2% PurCol (Advanced BioMatrix). 24 hours after transient transfection with mouse or human ENPP3 via Fugene 6 (Promega) ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Laure Coutos-Thévenot, et al.,
bioRxiv - Cancer Biology 2019
Quote:
Fluorescence based thermal experiments were performed using Prometheus NT.48 (NanoTemper Technologies, Germany) with capillaries containing 10 μL PPARγ WT or mutants at 4mg/ml ...
-
No products found
because this supplier's products are not listed.
Claudia Prahst, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 3% BSA (Nzytech), 0.5% Triton X100 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Natalie Burchat, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Plasma glucagon-like peptide-1 and -2 (GLP-1 and GLP-2) were measured by ELISA (RayBiotech, Peachtree Corners, Georgia and Crystal Chem, Elk Grove Village, IL, respectively).
-
No products found
because this supplier's products are not listed.
Angela Rubio, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... A total of 100 ng was used as input for the NEXTFLEX Small RNA Sequencing Kit (Version 3; Bioo Scientific), and libraries were generated following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Wenjuan Du, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plates were blocked with 3% bovine serum albumin (BSA, Fitzgerald) in PBS with 0.1% Tween-20 at 4℃ overnight ...