-
No products found
because this supplier's products are not listed.
Guilherme Vilela-Alves, et al.,
bioRxiv - Biochemistry 2024
Quote:
... crystals were obtained aerobically using the hanging-drop vapor diffusion method, from drops of 2 µL (1:1, protein:precipitant ratio) in 24 well plates (24 well XRL plate Molecular Dimensions) at 20°C ...
-
No products found
because this supplier's products are not listed.
Stefan Kol, et al.,
bioRxiv - Bioengineering 2019
Quote:
... the anti-CHO HCP Detection Kit (Pall) was used according to the manufacturer’s specifications ...
-
No products found
because this supplier's products are not listed.
Jozsef Gal, et al.,
bioRxiv - Biochemistry 2022
Quote:
... in the medium with the exception of the 293T-based CAPN5-3×FLAG stable cell line that was selected and maintained with 200 µg/ml hygromycin (Gold Biotechnology, H-270-1).
-
No products found
because this supplier's products are not listed.
Shenghui Xing, et al.,
bioRxiv - Microbiology 2021
Quote:
... Chemiluminescent detection was performed using an ECL fluorescence colorimetric kit (Tiangen) and fluorescent signals were visualized using a Bio-Rad Gel Doc XR ...
-
No products found
because this supplier's products are not listed.
Florian U Moeller, et al.,
bioRxiv - Microbiology 2019
Quote:
... we used the AOA-specific inhibitor PTIO (2-phenyl-4,4,5,5-tetramethylimidazoline-1-oxyl 3-oxide; Tokyo Chemical Industry) (Martens-Habbena et al. ...
-
No products found
because this supplier's products are not listed.
Kazuma Nakatani, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and the bound proteins were visualized using a chemiluminescence-based detection kit (ImmunoStar Zeta ...
-
No products found
because this supplier's products are not listed.
Lin Zhu, et al.,
bioRxiv - Microbiology 2023
Quote:
... or anti-STING (Bioss) antibodies overnight at 4°C ...
-
3',3'-cGAMP (3',3'-cyclic GMP-AMP, Cyclic GMP-AMP, cGAMP) activates the endoplasmic reticulum...
Cat# S7905, SKU# S7905-1mg,
1mg, $390.00
Ask
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The STING agonist diABZi (Selleck Chemicals) was used at 1 µM ...
-
No products found
because this supplier's products are not listed.
Hesam Montazeri, et al.,
bioRxiv - Genomics 2019
Quote:
... All cell lines were confirmed negative for mycoplasma infection using the PCR-based Universal Mycoplasma Detection kit (American Type Culture Collection, Manassas, VA) as previously described [42].
-
No products found
because this supplier's products are not listed.
Omid Mashinchian, et al.,
bioRxiv - Bioengineering 2022
Quote:
Serum cytokines were quantified using the ELISA based Quantibody Mouse Inflammation Array Q1 Kit (Raybiotech, QAM-INF-1-1). Following incubation of the cytokine-specific immobilized antibodies with serum and standard cytokines ...
-
No products found
because this supplier's products are not listed.
Agata Stepien, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... rat antibodies for the detection of phosphorylated RNAPII (serine 5 and serine 2) (Chromotek, 1: 100) and secondary goat anti-rat Alexa Fluor 488 antibodies (A-11006 ...
-
No products found
because this supplier's products are not listed.
Lulu Huang, et al.,
bioRxiv - Immunology 2020
Quote:
Immunohistochemistry detection was performed with the SABC kit (Boster Bioscience). Intrinsic peroxidase in samples was inactivated using 3% hydrogen peroxide after antigen retrieval was performed with buffer ...
-
No products found
because this supplier's products are not listed.
Alessandro Furlan, et al.,
bioRxiv - Neuroscience 2021
Quote:
... coconut oil-based HFD (Envigo; 1 g in 5 ml mineral oil), white chocolate (Lindt ...
-
No products found
because this supplier's products are not listed.
Samantha L. Wilson, et al.,
bioRxiv - Genomics 2021
Quote:
... Labs 1 and 3 used Antibody 1 (Diagenode, Denville ...
-
No products found
because this supplier's products are not listed.
Jonard C. Valdoz, et al.,
bioRxiv - Bioengineering 2022
Quote:
Suspension-based cell aggregates were collected and transferred to a MatTek glass bottom plate (P35G-1.5-14-C, MatTek, MA, USA) with minimal volume of complete cell media to prevent dehydration ...
-
No products found
because this supplier's products are not listed.
Stephanie M. Kronstadt, et al.,
bioRxiv - Bioengineering 2022
Quote:
... EVs were also quantified based on the amount of total immunoreactive CD63 within isolated EV samples using the ExoELISA-ULTRA Complete Kit (System Biosciences, EXEL-ULTRA-CD63-1) per the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Julien Spielmann, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Protein detection was carried out using polyclonal anti-IRT1 (Agrisera, 1/5,000) and anti-rabbit horseradish peroxidase-coupled (BioRad ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Rachel J Harding, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and K2 direct detection camera (Gatan) at 165,000x magnification ...
-
No products found
because this supplier's products are not listed.
Serdar Durdagi, et al.,
bioRxiv - Biophysics 2020
Quote:
For enzyme inhibition assessment Fluorescence Resonance Energy Transfer (FRET)-based cleavage assay by using 3CL Protease assay Kit (#79955-1 and #79955-2, BPS Bioscience, San Diego CA, USA) was used ...
-
No products found
because this supplier's products are not listed.
Amalia Sintou, et al.,
bioRxiv - Immunology 2019
Quote:
... Apoptosis assays were performed using Nucleocounter NC-3000 and a Flexicyte apoptosis/necrosis detection kit based on staining with caspase 3 substrate NucView 488 and RedDot 2 (all Biotium, Cambridge Bioscience, UK). Apoptotic cells are defined as NucView488 positive and RedDot2 negative ...
-
No products found
because this supplier's products are not listed.
Christopher J. Neufeldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... Rabbit anti-STING (Atlas Antibodies: HPA038534, IF – 1:100); Mouse anti-dsDNA (Abcam ...
-
No products found
because this supplier's products are not listed.
Yun Tian, et al.,
bioRxiv - Microbiology 2021
Quote:
... for PCR-based assays or a column-based RNA/DNA/protein purification kit (Norgen Biotek, Ontario, Canada) for transcriptomic analysis ...
-
No products found
because this supplier's products are not listed.
Elise Maurat, et al.,
bioRxiv - Physiology 2023
Quote:
... Detection was achieved with 2 internal photomultiplier tubes (PMT) and 2 internal hybrid detectors ...
-
No products found
because this supplier's products are not listed.
Andrea Salm, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 2-hydroxy-3-methylanthraquinone (13) and 2-hydroxy-1-methylanthraquinone (14) were obtained from Toronto Research Chemical, ON ...
-
No products found
because this supplier's products are not listed.
James B. Bower, Scott A. Robson, Joshua J. Ziarek,
bioRxiv - Biophysics 2024
Quote:
... The cells were used to inoculate 2L of H2O-based M9 media supplemented with 3 g L-1 of [U-13C6] d-glucose (Cambridge Isotope Laboratories, CIL) and 2 g L-1 of [15N] ammonium chloride (Cambridge Isotope Laboratories ...
-
No products found
because this supplier's products are not listed.
Gerd Ulrich Balcke, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Scheduled multiple reaction monitoring (MRM)-based metabolite detection was performed in negative mode electrospray ionization (ESI) on a QTrap6500 (AB-Sciex GmbH ...
-
No products found
because this supplier's products are not listed.
Xing Fang, et al.,
bioRxiv - Neuroscience 2022
Quote:
Cell contractile capabilities were compared using primary cerebral VSMCs (passages 2 – 4) with a collagen gel-based cell contraction assay kit (CBA-201, Cell Biolabs, San Diego, CA) following our optimized protocol 9,40,48,53,57,58 ...
-
No products found
because this supplier's products are not listed.
C. R. Coveney, et al.,
bioRxiv - Physiology 2021
Quote:
In situ detection of apoptosis was conducted using TACS® 2 Tdt-Fluor In Situ apoptosis kit (Trevigen, 4812-30-K), after deparaffinising sections.
-
No products found
because this supplier's products are not listed.
Lasse Kvich, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... filled to ∼1/3 volume with 2 and 0.1 mm diameter zirconia beads (Biospec, OK, USA) on ice ...
-
No products found
because this supplier's products are not listed.
Binhan Hao, Wenjie Zhou, Steven M. Theg,
bioRxiv - Biochemistry 2022
Quote:
... Proteins were visualized using ProSignal Pico ECL Western Blotting detection kit (Genesee Scientific).
-
No products found
because this supplier's products are not listed.
Kerri L. Miazgowicz, et al.,
bioRxiv - Microbiology 2022
Quote:
... Transfected cells were rapidly cooled and stained in blocking solution (dPBS with 2% (v/v) bovine serum albumin (BSA)) containing anti-MXRA8 (1:100, W040-3, MBL International), anti-hTIM1(1:100 ...
-
No products found
because this supplier's products are not listed.
Paul J Banks, E Clea Warburton, Zafar I Bashir,
bioRxiv - Neuroscience 2020
Quote:
... were targeted under oblique infra-red illumination based on somatic morphology and patch clamped using 2-6 MΩ boroscillicate glass electrodes (GC150-10F, Harvard Apparatus) filled with potassium gluconate internal for current-clamp experiments (in mM ...
-
No products found
because this supplier's products are not listed.
Ranjan Sengupta, et al.,
bioRxiv - Cell Biology 2019
Quote:
Cell pellets (2-3 μl) were loaded onto copper membrane carriers (1mm x 0.5 mm; Ted Pella Inc.) and cryofixed using the EM PACT2 high pressure freezer (Leica) ...
-
No products found
because this supplier's products are not listed.
Jennifer O’Brien, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and chicken anti-beta-tubulin 3 (Aves Labs, TUJ-0020, 1:500).
-
No products found
because this supplier's products are not listed.
Xingyue An, et al.,
bioRxiv - Immunology 2020
Quote:
... 2′-3’′cyclic guanosine monophosphate adenosine monophosphate (cGAMP) from Chemietek (Indianapolis, IN). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) ...
-
No products found
because this supplier's products are not listed.
Vilma Väänänen, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Horseradish peroxidase-based detection was carried out using EnzMet General HRP Detection Kit (Nanoprobes, ref 6010-15mL). Before detection ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... and purified Tregs at a ratio 1:1 in 96-well plates pre-coated with gelatin-based coating solution (from Cell Biologics, Euromedex).
-
No products found
because this supplier's products are not listed.
Wei Liu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The STING mRNA was co-transcriptionally capped using CleanCap (TriLink) and purified as described previously [70] ...
-
No products found
because this supplier's products are not listed.
Caroline M. Nieberding, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... A custom normalization step (based on the EVROGEN Trimmer kit) was optimized in collaboration with the Roche R&D department and applied to the cDNA libraries ...
-
STING agonist
Sold for research purposes only.
Cat# 3688.0, SKU# 3688-1 mg,
Inquire
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
Antonios Apostolopoulos, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... (e-Myco VALiD Mycoplasma PCR Detection Kit, iNtRON Biotechnology).
-
No products found
because this supplier's products are not listed.
Vivek K. Dwivedi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 24-well plates with each well containing 2 mL NGM medium with 1 mM IPTG (Amresco) and 75 mg/L ampicillin were prepared in advance and stored at 4°C until needed ...
-
No products found
because this supplier's products are not listed.
Choon K. Sim, et al.,
bioRxiv - Microbiology 2021
Quote:
Free xylose levels were quantified using a colorimetric-based D-xylose assay kit (Megazyme). Stool samples were weighed ...
-
No products found
because this supplier's products are not listed.
Christopher J. Black, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A roughly ∼2-4mm craniotomy and 2-3 pilot holes were drilled using a micro drill (Stoelting). Stainless steel screws (000-120 ...
-
No products found
because this supplier's products are not listed.
Susanne Wiemann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were washed 3 times in PBS and incubated for 2 h with adequate secondary antibody (Dianova, Hamburg, Germany; Table 1) solution without Triton™-X-100 ...
-
No products found
because this supplier's products are not listed.
Otun Saha, et al.,
bioRxiv - Microbiology 2020
Quote:
... were selected for 16S rRNA gene PCR using universal primers (27F 5’-AGAGTTTGATCMTGGCTCAG-3’ and 1492R 5’-TACGGYTACCTTGTTACGACTT-3’) followed by sequencing at First Base Laboratories SdnBhd (Malaysia) using Applied Biosystems highest capacity-based genetic analyzer (ABI PRISM® 377 DNA Sequencer) platforms with the BigDye® Terminator v3.1 cycle sequencing kit chemistry (Masomian et al. ...
-
No products found
because this supplier's products are not listed.
Melis D. Arslanhan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mouse anti Centrin-3 (1:1000, Abnova, H8141-3EG), mouse anti V5 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Angel Justiz Vaillant, Patrick E. Akpaka,
bioRxiv - Immunology 2020
Quote:
... The protein concentration of purified IgY (Ab-1 and Ab-3) was assessed by a commercially available ELISA kit (MyBiosource, Inc), which protocol was performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Kayarash Karimian, et al.,
bioRxiv - Molecular Biology 2024
Quote:
A modified DNA extraction protocol was used to produce high molecular weight DNA based on the Lucigen/EpiCentre’s MasterPureTM Complete DNA and RNA Purification Kit A (Biosearch Technologies, Cat MC85200). For HG002 cell line ...