-
No products found
because this supplier's products are not listed.
Helen J. von Richthofen, et al.,
bioRxiv - Immunology 2022
Quote:
... or proteinase 3 (Elastin Products Company) (all 1 μM) ...
-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Kevin J Pridham, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3% fetal bovine serum (Peak Serum, Inc.), 10 X G-5 Supplement (Gibco) ...
-
No products found
because this supplier's products are not listed.
Jijin R. A. Kuttiyatveetil, et al.,
bioRxiv - Biochemistry 2021
Quote:
... ICP-MS standards QCP-QCS-3 (Inorganic Ventures) and QCS-27 (High Purity Standards ...
-
No products found
because this supplier's products are not listed.
Eman A. Akam, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Tert-Butyl 3-aminopropoxycarbamate was purchased from AmBeed and used without further purification ...
-
No products found
because this supplier's products are not listed.
Shintaro Maeda, Chinatsu Otomo, Takanori Otomo,
bioRxiv - Cell Biology 2019
Quote:
... and 1% 1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate (DiD) (Marker Gene Technologies)) as indicated in Fig ...
-
No products found
because this supplier's products are not listed.
Federica De Leo, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 3 hours before muscle injection with 50 µL of 15 µM cardiotoxin (Latoxan). After 6 hours ...
-
No products found
because this supplier's products are not listed.
Hannah M. Starnes, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... PFOS (CAS 2795-39-3, purity ≥ 98%) was from Matrix Scientific (Columbia, SC), and 1H,1H,2H,2H-perfluorooctanol (6:2 FTOH ...
-
No products found
because this supplier's products are not listed.
Zachary A. Kemmerer, et al.,
bioRxiv - Cell Biology 2020
Quote:
... cerevisiae genome assembly and variation calling were performed with SeqMan NGen 14 and ArrayStar 14 (DNASTAR Lasergene suite). Variant D-Score predictions were obtained using the PROVEAN v1.1.3 web server (http://provean.jcvi.org/seq_submit.php).
-
No products found
because this supplier's products are not listed.
Allison M. Owen, et al.,
bioRxiv - Immunology 2022
Quote:
Fresh buffy coat samples collected in EDTA from healthy male donors (age range 22-56; 14% Caucasian, 57% Hispanic, and 14% Black) were purchased from BioIVT. Samples were collected under IRB-approved protocols and were shipped the same day of collection ...
-
No products found
because this supplier's products are not listed.
Cameron L. Woodard, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Pipettes (3-5Ω) were pulled from borosilicate glass capillaries using a micropipette puller (Narishige International). The intracellular solution was cesium-based and contained the following in mM ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolomé Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=3) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Mackenzie T. Walls, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... the overnight culture was used to inoculate 3 mL of SC media (Sunrise Science Products) with 2% (w/v ...
-
No products found
because this supplier's products are not listed.
Sylvia Mutinda, et al.,
bioRxiv - Plant Biology 2022
Quote:
... the seeds were pre-germinated by adding 3 ml of 0.1 ppm GR24 (Chiralix, Nijmegen, Netherlands) and incubating overnight at 30 °C.
-
No products found
because this supplier's products are not listed.
Mary E. Herndon, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Endogenous peroxidase activity was quenched with 3% hydrogen peroxide and Background Buster (Innovex Biosciences; Richmond, CA) was used to block non-specific staining ...
-
No products found
because this supplier's products are not listed.
Lucy Chou-Zheng, Asma Hatoum-Aslan,
bioRxiv - Microbiology 2019
Quote:
... The most concentrated fractions (3 ml total) were pooled and mixed with SUMO Protease (MCLAB, CA, USA) and provided SUMO buffer (salt-free) ...
-
No products found
because this supplier's products are not listed.
Renee J. Tamming, et al.,
bioRxiv - Neuroscience 2019
Quote:
Brains from 3-month-old mice were stained using the FD Rapid GolgiStain Kit (FD Neurotechnologies, Inc). They were then flash frozen and sectioned on a cryostat at 100µm thickness and further processed as per kit instructions ...
-
No products found
because this supplier's products are not listed.
Martina Ruglioni, et al.,
bioRxiv - Biophysics 2023
Quote:
Cells were seeded (3×105) in 35 mm glass-bottom dishes (WillCo Wells BV, Amsterdam, The Netherlands) with 2 ml of culture medium and maintained at 37°C and 5% CO2 for 24 prior to transfection (vide infra ...
-
No products found
because this supplier's products are not listed.
Stephen W. Wietgrefe, et al.,
bioRxiv - Immunology 2022
Quote:
... Supernatant p24 was measured on day 14 by ELISA (Zeptometrix) per manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Ashley Kidwell, et al.,
bioRxiv - Physiology 2021
Quote:
... Y-3 hybridoma cells (ATCC HB-176) were incubated in a membrane cell culture flask following the manufacturer’s instructions (Wheaton CELLine Bioreactor Flask and Hybridoma-SFM ThermoFisher 12045076) ...
-
No products found
because this supplier's products are not listed.
Mathieu Richard, et al.,
bioRxiv - Biophysics 2019
Quote:
... glass coverslips were oxidized with an oxygen plasma for 3 min and incubated with 0.1 mg/ml Poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG; Jenkem Technology) in 10 mM HEPES at pH = 7.4 for 30 min ...
-
No products found
because this supplier's products are not listed.
Maia Moog, Scott C. Baraban,
bioRxiv - Neuroscience 2022
Quote:
... were amplified at a gain of 20x and filtered at 1 kHz (−3 dB; eight-pole Bessel; Cygnus Technology, Inc.), digitized at 10 kHz using a Digidata 1320 A/D interface (Molecular Devices ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Shiwei Liu, et al.,
bioRxiv - Genomics 2020
Quote:
... parasites were grown in vitro at 37°C in solutions of 3% hematocrit (serotype A positive human erythrocytes, Valley Biomedical, Winchester, VA) in RPMI 1640 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Matthieu Fritz, et al.,
bioRxiv - Microbiology 2023
Quote:
... and amplicons approximately 2–3 kb in size were excised from the gel and purified using the Quick-spin PCR Product Purification Kit (iNtRON Biotechnology, Korea). The amplicons were further cloned in pJET1.2 cloning plasmid (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Jingyou Yu, et al.,
bioRxiv - Microbiology 2021
Quote:
... The plates were washed with ELISPOT wash buffer (11% 10x DPBS and 0.3% Tween20 in 1L MilliQ water) and incubated for 2 h with Rabbit polyclonal anti-human IFN-γ Biotin from U-Cytech (1 µg/mL). The plates were washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase from Southern Biotech (2 µg/mL) ...
-
No products found
because this supplier's products are not listed.
Justin T. Savage, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The cells were then filtered through a 20μm nylon mesh (Elko Filtering, Cat# 03-20/14) to remove clumps ...
-
No products found
because this supplier's products are not listed.
Elin MV Forsberg, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... genomic DNA was prepared from TILs and CAR-TILs 10-14 days after the start of REP by lysing in Direct PCR Lysis Reagent (Nordic BioSite) and proteinase K ...
-
No products found
because this supplier's products are not listed.
Delphine Guillotin, et al.,
bioRxiv - Cell Biology 2020
Quote:
... REC reference 13/LO/1546) were grown from explant cultures as previously described.[14] Primary adult HSCs were obtained from Zen-Bio (#HP-F-S). RNAseq was performed on control pHLFs as described in [15] (GSE102674) ...
-
No products found
because this supplier's products are not listed.
Hannah Varner, et al.,
bioRxiv - Bioengineering 2023
Quote:
Whole blood clots were prepared from bovine blood collected with CPDA-1 anticoagulant at 14% volume anticoagulant/total volume and derived from a single donor animal (Lampire Biological Laboratories, PA,USA) (Sugerman et al. ...
-
No products found
because this supplier's products are not listed.
Paulus Mrass, et al.,
bioRxiv - Immunology 2022
Quote:
... We used the following antibodies: H3N2 virion antibody (ViroStat, Cat#: 1317); anti-mouse CD107A ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals) at a dilution of 100 folds ...
-
No products found
because this supplier's products are not listed.
Júlia Vallvé-Juanico, et al.,
bioRxiv - Immunology 2022
Quote:
... the antibodies were resuspended with Antibody Stabilizer (Boca Scientific, Dedham, MA, USA) at a concentration of 0.2 mg/ml and stored at 4°C ...
-
No products found
because this supplier's products are not listed.
Jie Zhu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and Piccolo (Anti-Antibody [6H9-B6] and StressMarq Biosciences INC; Anti-Piccolo antibody (ab20664) Abcam ...
-
No products found
because this supplier's products are not listed.
Avais M. Daulat, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CLASP2 antibody was obtained from Absea Biotechnology ltd ...
-
No products found
because this supplier's products are not listed.
Huilei Wang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Collagen IV polyclonal antibody (Assay Biotech, C0157), GAPDH mouse monoclonal (Novus Bio ...
-
No products found
because this supplier's products are not listed.
Hoyun Kwak, et al.,
bioRxiv - Genetics 2020
Quote:
... The purified antibodies were conjugated with HRP or Alexa 488/Cy3 using an antibody labeling kit (Expedeon, United Kingdom) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
James A. Gregory, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and anti-HA antibodies (Immunoreagents #MuxOt-111-DALP), biotin conjugated anti-HA (Biolegend 901505 ...
-
No products found
because this supplier's products are not listed.
Michael Bowe, et al.,
bioRxiv - Immunology 2023
Quote:
... and secondary IgA and IgM antibodies (Brookwood Biomedical).
-
No products found
because this supplier's products are not listed.
JM Sweeter, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Mouse AECs were stained for Muc5b by mouse monoclonal antibody 3AE (27) and rabbit antibody Scgb1a1 (Seven Hills BioReagents WRAB-3950).
-
Rabbit polyclonal antibody to 14-3-3 zeta
Cat# CPA2244,
200 ul USD $350.0, 100 ul USD $220.0, 30 ul USD $110.0
Ask
Rafał Zdrzałek, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Respective primary HRP-conjugated antibodies (α-FLAG: Cohesion Biosciences, CPA9020 ...
-
No products found
because this supplier's products are not listed.
Roie Cohen, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Samples were then incubated overnight at 4°C in the appropriate primary antibody diluted in antibody diluent buffer (GBI labs cat: E09-300). Following 3 washes in PBS ...
-
No products found
because this supplier's products are not listed.
R Barbieri, et al.,
bioRxiv - Microbiology 2020
Quote:
... the paraffin sections were incubated with anti-glycophorin A antibody JC 159 (Mouse Monoclonal Antibody, ref: Mob 066-05, Diagnostic BioSystems, Nanterre, France) at a 1/500 dilution using a Ventana Benchmark autostainer (Ventana Medical Systems ...
-
No products found
because this supplier's products are not listed.
Han-Wei Shih, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Alexa 647-conjugated anti-CWP1 antibody (Waterborne, New Orleans, LA) was used at 1:2,000 ...
-
No products found
because this supplier's products are not listed.
Jack George, Howard T. Jacobs,
bioRxiv - Molecular Biology 2019
Quote:
... custom rabbit polyclonal antibodies (21st Century Biochemicals, both 1:5000), GAPDH (Everest Biotech EB06377 ...
-
No products found
because this supplier's products are not listed.
Ludmila Recoules, et al.,
bioRxiv - Genomics 2021
Quote:
... Rabbit anti- mH2A1.1 antibody was generated according to immunization protocol from Agro-Bio - La fierté Saint-Aubin – France ...
-
No products found
because this supplier's products are not listed.
Xi Chen, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Liver slides were stained with goat-anti-hFIX antibody (1:2000, Affinity Biologicals, GAFIX-AP). Subsequently ...
-
No products found
because this supplier's products are not listed.
Swastik Phulera, et al.,
bioRxiv - Biophysics 2024
Quote:
... The virus titer was determined by gp64-PE mouse anti-baculovirus antibody (Expression Systems, CA) using a Guava benchtop Flow Cytometer (Millipore ...