1 - 50 of 548
suppliers found for
10 Methylundecanoic acid
» view 10000+ matched products-
BOC Sciences Sponsored
Cat# 2724-56-3, Inquire Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... 10 μM lysophosphatidic acid (LPA) or 10 mM kynurenic acid (KYNA) (both Sigma-Aldrich). Zaprinast (Sigma-Aldrich ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... 10% non-essential amino acids (Life Technologies), and 1% Pen-Strep (Life Technologies) ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018Quote: ... 10% v/v acetic acid (Merck) and 50% v/v methanol (VWR) ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2019, published in Nature Structural & Molecular Biology doi: 10.1038/s41594-019-0236-8Quote: ... 10 µM amino acids mixture (Promega), 1 U/µL murine RNase inhibitor (NEB) ... -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... N-methyl-D-aspartic acid (NMDA, 10 μM; Tocris 0114) or kainic acid (Tocris ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.Cited in Exploration of synergistic action of cell wall-degrading enzymes against Mycobacterium tuberculosisbioRxiv - Microbiology 2021Quote: ... 10% oleic acid-albumin-dextrose-catalase supplement (OADC; BD Diagnostics), 0.5%V/V glycerol ... -
Corning
No products found because this supplier's products are not listed.Cited in Wolbachia and virus alter the host transcriptome at the interface of nucleotide metabolism pathwaysbioRxiv - Microbiology 2020Quote: ... 1% non-essential amino acids and 10% heat inactivated Fetal Bovine Serum (FBS)(Corning™). SINV (strain TE3’2J-GFP (Huang et al. ... -
VWR
No products found because this supplier's products are not listed.Cited in Genome-wide in vivo screen of circulating tumor cells identifies SLIT2 as a regulator of metastasisbioRxiv - Cancer Biology 2022Quote: ... membranes were submerged in 750 μL of 10 % acetic acid (VWR) with shaking until completely dissolving the stain ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2020Quote: ... 10 mM ascorbic acid) containing a protease inhibitor cocktail (Roche). All subsequent steps were conducted on ice ... -
Cayman Chemical
No products found because this supplier's products are not listed.Cited in Deletion of murine IQGAP1 results in increased mTOR activation and blunted ketogenic responsebioRxiv - Physiology 2017, published in JCI Insight doi: 10.1172/jci.insight.99866Quote: ... and free fatty acids (Free Fatty Acid Fluorometric Assay Kit, Cayman Chemical). All assays were performed according to the kit instructions ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2018Quote: ... supplemented with 10% fetal bovine serum and 1% non-essential amino acids (Lonza). Cells were mycoplasma-free ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in Journal of Biological Chemistry doi: 10.1074/jbc.RA118.005933Quote: ... Kainic acid (Abcam ab144490) was diluted from 10 mM/ml to 300µM/ml in primary cultured media and added to motor neurons for 10 minutes followed by a replacement with glia-conditioned media for one hour ... -
Agilent
No products found because this supplier's products are not listed.Cited in Fibrillar Aβ causes profound microglial metabolic perturbations in a novel APP knock-in mouse modelbioRxiv - Neuroscience 2021Quote: ... Mobile phase A consisted of water with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ... -
CDN Isotopes
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2017, published in Science Signaling doi: 10.1126/scisignal.aao3070Quote: ... Shaking was repeated after addition of 400 μl extraction buffer (10 % methanol, 1 % acetic acid) with internal standards (10 ng Jasmonic-d5 Acid, 28 ng Salicylic-d4 Acid; CDN Isotopes, Pointe-Claire, Canada) before samples were incubated on ice for 30 min and centrifuged for 10 min at 16,000 g and 4°C ... -
Alfa Aesar
No products found because this supplier's products are not listed.bioRxiv - Systems Biology 2017, published in eLife doi: 10.7554/elife.32110Quote: ... or 10 mM p-Coumaric acid (trans-4-hydroxycinnamic acid; Alfa Aesar A15167), and incubated overnight at 30 °C with 200 rpm shaking ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018Quote: ... in B27 medium supplemented with 200 µM L-ascorbic acid and 10 µM DAPT (Calbiochem) for 7 days (day 27 ... -
Cambridge Isotope Labs
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in Nature Communications doi: 10.1038/s41467-020-15876-8Quote: ... 15N-labeled amino acids (10 mM; Cambridge Isotope Laboratories), or keto acids (20 mM ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2019, published in PLOS Genetics doi: 10.1371/journal.pgen.1008433Quote: Jasmonic acid-d0 and jasmonic acid-d5 were obtained from Santa Cruz Biotechnology ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... 10 ug/mL lipoteichoic acid (LTA) from Staphylococcus aureus (Invivogen), pseudotyped virus or SARS-CoV-2 ... -
Stemcell Technologies
No products found because this supplier's products are not listed.Cited in Reversal of ageing- and injury-induced vision loss by Tet-dependent epigenetic reprogrammingbioRxiv - Molecular Biology 2019Quote: ... and 10 µM all-trans retinoic acid (ATRA, Stemcell Technologies, 72264) (Differentiation Medium 1) ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... 10% acetic acid v/v and brilliant Coomassie blue (BioRad G250). For Western blotting ... -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2019, published in Nucleic Acids Research doi: 10.1093/nar/gkz954Quote: ... or adipic acid (TCI, CAS Number:124-04-9 Product Number ... -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020, published in Journal of Bacteriology doi: 10.1128/JB.00039-20Quote: ... then adding 90 µL to each well such that the final concentration of the bile acid after the addition of cells (10 µL) ranged from 0.04 mM to 10 mM for CA (102897, MP Biomedicals), and 0.01 mM to 2.5 mM for DCA (D6750 ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2022Quote: HUVECs were transfected at 60% confluency with 10 nmol/L locked nucleic acid (LNA) GapmeRs (Qiagen) or small interfering RNAs (siRNAs ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... and incubated 10 minutes at 37 °C by addition of 1 μCi/ml of L-[3,4-3H]-Glutamic acid (Perkin Elmer, NET490) and 10µM L-glutamate (Sigma) ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: 15-mer peptides that are overlapping by 10 amino acids (AA) spanning the entire SARS-CoV-2 Spike protein (GISAID EPI_ISL_410713) were synthesized (Genscript) and pooled into 7 pools of approximately 40 peptides in each pool (Supplementary Table 1) ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2018Quote: ... Gels were fixed in 40% methanol/10% acetic acid solution and stained with Coomassie brilliant blue R-350 (GE Healthcare). The spots were normalized and evaluated by the software ImageMaster 2D Platinum 7.0 (GE Healthcare). -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2021Quote: ... 10 μg of nucleic acid was digested with 5 μL RNase H (NEB) at 37°C for 16 hours and 10 μg was mock digested without RNase H ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.Cited in Differential tissue stiffness of body column facilitates locomotion of Hydra on solid substratesbioRxiv - Biophysics 2020Quote: ... 1% Tannic acid (EMS) and 1 % Uranyl acetate (EMS) ... -
Biotium Inc.
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... at 80°C for 10 minutes in 10−4 final dilution of commercial stock as described earlier (35) or with GelRed nucleic acid gel stain (Biotium,10−4 final dilution of commercial stock ... -
Zymo Research
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2021Quote: ... 10 mL 5-Fluoroorotic Acid (Zymo Research), 50 mg uracil (MP Biomedicals 103204) ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: ... 10 pmol phosphatidic acid (21:0/22:6, Avanti Polar Lipids), 10 pmol phosphatidylglycerol (14:1/14:1 ... -
Phenomenex
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2022Quote: ... dried lipids were re-dissolved in 40% UPLC solvent B (90% 2-propanol/10% acetonitrile/0.1% formic acid/10 mM NH4HCO3) and transferred to silanized glass inserts (Phenomenex) using Hamilton syringes ... -
Lucigen
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2017, published in RNA Biology doi: 10.1080/15476286.2017.1409930Quote: ... 10 ug of RNA was decapped by treatment with Tobacco Acid Pyrophosphatase (TAP) (Epicentre) to provide 5’-monophosphorylated terminus that was ligated to a 3’-hydrohylated terminus by T4 RNA ligase 1 (NEB ... -
Chem Impex International
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2022Quote: ... incubated for >10 days with 0.1% acetic acid containing 500mM L-Ribose (Chem Impex International) (crosslinked ... -
Molecular Devices
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... BODIPY-dodecanoic acid fluorescent fatty acid analog was added (QBT™ Fatty Acid Uptake Assay Kit, Molecular Devices) and the plate was immediately transferred to a fluorescence microplate reader for kinetic reading (every 20 seconds for 30-60 minutes ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2020Quote: ... non-essential amino acids and human FGF2 at 10 ng/mL and human BMP4 at 20 ng/mL (both Peprotech) until day 18 ... -
New Objective
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: ... using a 300 nL/min flow rate of mobile phase A (0.1% formic acid) and separated in a C18 PicoFrit PepMap (10 cm x 10 μm x 75 μm; 135 Å pore, New Objective), over 105 minutes using a linear gradient 2-30 % followed by 20 min of 30-45% of mobile phase B (100% ACN ... -
Polysciences
No products found because this supplier's products are not listed.Cited in The β-Carotene-Oxygen Copolymer: its Relationship to Apocarotenoids and β-Carotene FunctionbioRxiv - Biochemistry 2020Quote: A sample of lycopodium sporopollenin (50 mg in 10 mL acetic acid; Polysciences Inc., Warrington PA) was ozonized in a similar manner ... -
MedChemExpress
Cat# HY-Y0148-10 mM * 1 mL, 10 mM * 1 mL, USD $55.0 AskbioRxiv - Developmental Biology 2022Quote: ... To activate the phosphorylation of ERK1/2 or suppress the expression of PPARγ, the cell was treated with 10 μM pamoic acid (Macklin, Shanghai, China) or 10 μM GW9662 (MedChemExpress, Monmouth Junction, NJ, USA) for 24 hours ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2018Quote: ... was induced by supplementing the culture medium with 50 μg/ml ascorbic acid and 10 ng/ml human VEGF (R&D System). -
AdipoGen Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Immunology 2022Quote: ... or heptelidic acid (Adipogen, #AG-CV2-0118-M00, 10 μM). -
Pan Biotech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2022Quote: ... 10 µM sodium pyruvate and 1x MEM non-essential amino acids (Pan Biotech)) ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... acid alcohol (Leica) for 5 s ... -
Megazyme
No products found because this supplier's products are not listed.Cited in Classifying interactions in a synthetic bacterial community is hindered by inhibitory growth mediumbioRxiv - Microbiology 2022Quote: ... Citric acid kit: Citric Acid Assay Kit (Megazyme, product Code: K-CITR). Phosphate kit ... -
3M
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... Digested peptides were acidified with 10% formic acid (FA) to pH ∼2 and desalted using stage tips with Empore C18 SPE Extraction Disks (3M) and dried under vacuum. -
Click Chemistry Tools
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2019, published in eLife doi: 10.7554/eLife.49806Quote: ... artificial amino acid-containing base was incubated at room temperature with 150 µM 5,5′-dithiobis-2-nitrobenzoic acid for 10 minutes before chilling on ice and adding 300 µM DBCO-Cy3 (Click Chemistry Tools) and incubating at 4°C overnight ... -
American Radiolabeled Chemicals
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... [14C]nicotinic acid and [14C]uric acid were from American Radiolabeled Chemicals. Anti-SGLT2 and anti-Na+/K+-ATPase antibodies were obtained from Santa Cruz Biotechnology. -
Atlanta Biologicals
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020, published in Journal of Biological Chemistry doi: 10.1074/jbc.RA120.013752Quote: ... 10% FBS (Atlanta Biologicals), 1% penicillin and streptomycin ...